Erinaceus_europaeus Locus Mono:6:SNORD22
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:6:SNORD22
Erinaceus_europaeus
Mono:6:SNORD22
scaffold_374143
SNORD22
1001..1133
2133
AGGTGAGAAAATGAAAGCCTGACTTTAAACCAGTAGTGAGCATTAGACAGGATCTTTGT
ATCAGAAATGTCTACAGAGTTGATTGTCCAGAGTGGAAGTCAGAGATAAAATGTGAAATC
AAATGCTGATGACAGGAACTGCCAAAATCTTCTCTCAGTGTTCTCTTCTCTCTTTCACTT
CCATGATTAGAAAAGAAAGAAAAAAAAACATCAGAGAGCATGGTATATAACTACATATAG
TTGTCAATACAAGCTTTATTAAATAACCAATTAGAATTCACCCTCCAATGTATAAGACGA
ATTTTCACCTACATCTTCATTCATAAGTATCCTTGTTAAAGATTGTTTAGTAAACTGTGA
AAAGAAAGAATTTTGCCTTCCTGGTTTCCCACTTTCACTAATAGCAGACAGACGGAGAGG
GAAAGAGGTTTTCTTTTCCCTTTGGAAAGGAAACACGGAGCTGCGAGGTAAGAATGGAAA
ATCCTCTAAGCCAGCCAGATCAGTAAAAGCTATCCAAGTCATCTGCACTGATAAATATTA
TATCCAAGTCACCTGTGCATACAGGAGGGTCCTCCTGACCCTGTGCTTGGTGTGTTTTCT
GACACTCTGGCAAGCACCTGAGGAACCTAAGCTACAAGTCTATATTGAAACATACACTAT
AATGATCATTCCAACCCTGTTGTATCTCCAGGGAGGATGCACAATTGCCCCCCCATTACA
AGGTTTTATTCTCTTTATCTAATCATAAACTGAATTTAGAAAACTCAGAAGATGATATAG
CACTGAAAATAATCATAAATAAAAGTCATTTATATTATATCTTACTAGAGATATAATTCA
TATGAATTTTAATCCAGTTGGTAGGAAGATGAAGCACTCTGAACTTCACAAAACAACTTT
AACTCCTTACACTTAAAAAGAGAGGGAACAAATACCTAGCTTTTGTCCAAGGAAACTAAG
CAAAAGTGATGCATCATTTGTCAATTAAGAAAGTTAGGACATCTCGGTGAAGAAACACCC
AAATGTTTTACCTCCTGTCCTAGTCCCAGAGCCTGCAAAGGTGAACCCACTGAGACTGGC
TGGAGGTGAAGGGGGGAAGAGGAAATTTGTTCCAGAAGGAACTGTCTGAGGGATTAGCCG
GACTCTGCTGACTACATAAAGTAGTGATTCCCATCTAATAAAAACTTCAAGAAAAAAAAA
AGTTAGGATAAAAAGTGTCCTGTTCCCTTCCTCCCTTCCTTGCGCACCTACTAGCTGAAT
GATTCCAGTAATTTGAAGTCATGTACTAAGCTTGTGAGAATCATAGAGAAATTCAAAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATATTTAT
TTGTTTCATCAGCTGTCATTATTTAATCTGATATTACTAATGTGAAATCATACTGTATTT
ATTATCTTGCTGTTTCTAAAAATATTTTTATTTGTTATTGGATAGAAACAGAGAGAAATG
AAGAGTGGAGGAAGAGCTAGAAGAGGATAGAGACAGAGATACACTTGCGGCCCTACTTCA
CCACTTGTGAAGCTTTCCTTCTGCAGGGGGGGGGCCAGGGACTTGAACCTGGGCCCTTGC
ACAGGGTAATGTGAGCCAGCACTTAACTAGGCGCCCTACCCCCCGGGTCCGCCAATTTTT
CCTTCCGGGGTACTTAGTGAGTTATTTCCTATATCTTTATTTCTGAAAAATATTAAATCT
ATTTTCTATGGCAAAATTCATTGTGACAGTGATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved