Erinaceus_europaeus Locus Mono:42:SNORD113
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:42:SNORD113
Erinaceus_europaeus
Mono:42:SNORD113
scaffold_285696
SNORD113
1001..1072
2072
AATAAATAAGTAAATAAAAAAGTTGTAAAAAGAATTACAACATAAAAGGAGCAATAATA
TATTTTAACTGATTCTTATTTATTTAACTTGCCACCAATGTTATCATTGAGTTTGGTGCC
TGCACAACAAACTCCCTGCTCCTGGAGACAATTTTTCTTTTTCTTTTTTTGCTTTCTATT
TTATTGGGTAGGACAGAGAGAAATTAAGAGGCGAGGGGAAGATAGGGAAGGAGCGAGGAA
GAGAGACAGCTGCAGACCTGCTTCAACATTCAGTTGAGAGTTCCAGGTCTGTGCTCGTGA
TCAGTGTCATGGTGAAGAACGTGTTTATAACGTCTAAACTACATCCTCAGTCATTTTCCT
TCTTCTCCTGAATGAGCCACCACAGTGGAGTCCGTCGCCGTCCAGTCTTGGTGAAGAGCT
TGGCAGTTCCTCTGCAGGTAAGGCGTGTGATAGGTGGCAGTCAGTGTTCCTCTCTTGCTT
AGTGGATTCTCTCATTTGTTGTCACTGAGAGTGTTCAGTGAAGCAAAAGGCTATACACAT
GTAAAACAAAAAAAATCCCAGAACATTCTACTTACTGACTAAATGAAGAAGGGGTCAAAA
ATGGCCATTCCTTATTTCAGTTCCACTTTGATCCATTTTTCCATGAGTTGGAAGAAGTAT
AGAGAGCTGTGAGAACTTAGACGAATCTCGTAGAAGATAAACCCTATTGTACATGTTCAA
GAATCTTAAGGATGATTTATTTTTATTGCTTTATTTTTTTGGTGGTCCATTCTGCCAAGT
TTCAAGCCAGTGAGGTTGATTGGCAGTGACCTAATCAAGGATCATGGCTTGTGCCGGGAA
TTGAGGAGGTCATCTCCGCACTGAGACTGAGTTTGAGCTCCCTCGGTGCTGTGAGAACTA
AGGCCAGAGACAGATTGCAGTGAAATCAAACACAGAAATCTAGGGCCTTGATGATTCACT
AGAATATGGAAGTACAAATGAGTGAAATCACAGCGCCATCTTAGTCCAGTGATGAGACTG
GAGGGTGTCTGAATCAGAAACTTTGATTATCTCATTGTCACTCTGAGGTCCTTTATTTAA
GAGCGGCCTCCTCCTCCCCTATTCACACCAGCTTGGTAGCAGAAGTGTCAGAGCACTGAG
TATTAGATTGGCATCTTGATCATGCGTGTGCTCACGCTGGGCATGTTGATTGAATTTATG
TAAGTTAAACCATGTACTAATAAGATGCTTTTATTAATATGAACTAATGACGAGCATATA
TCCGGAGACACGGATCATGTTAAAACACTTTTGGAGCACTGAATTTCAATTGAACAATTT
AAAAGTGGGCAAACCATGACCCAGTGAGAAGAAAAACAAAGCCGTAACATCAGAACAACT
GCAGTCAAAATAAGAGAAAAGACATTTTATTCGTTTCCAAAGCTGATGACTAGTCTTACA
CTGCATTGGGTTGAAAGATTAATTCACTAATAACATTGACTGCACTGTCCAGTGTGACCT
CCCCCTCCAGTCTCAGTCTAGATTTATCTGTTTAAATTTAAGTAATTAAGTAAACACTTG
ATAGTTCATGTGACTTGATGTGTTCTCAAAACTTCTATTAGACTTTGGTCATAACTGTTA
ATCCCCAGAGGCACAGCAGGGAGTTTATAGCAAGGTGCAGGGATAAATTTGCTTGAATCA
ACAGTGTTAACTGACCCATTTAGACCTTACCAAGGATATCTATACCAAAAATCGCAATTA
CTGACACAAACTGTGTTGTGTTATAGACACAGATCTTGGTCATAACCAAGGATCCTGTTC
TTGAGTTTGTTTTTTTTTTTAATTCATACGATATTGATTTTTGTCACTGTCAGTGGGTCA
ATAAACAAAGGAGGAAAGAGAGAAAAAGATTTCTTTGTCTGAAACAATGATTTGTAATTT
AAAGGATATCTTTAGTGACTGACTATAGCTTTAACAATTGGGGAAATATAAAGTGCCAGG
AATATATTTTCATTAGGCCCTCGAACTCTGAGGTCCTGTGTAAGGTGGCACTACCTGCTA
TTCCCCCAGGCTGTGAACTTTCTTCTAGGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved