Erinaceus_europaeus Locus Mono:340:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:340:SNORD116
Erinaceus_europaeus
Mono:340:SNORD116
scaffold_132890
SNORD116
1001..1097
1532
GCTTGGAGGATTTTGAACAGTCATCCGGCCTTTGCTTCCTGCAGAGGGCAGTGTTGTGC
GCCCTGAGGAGGGTGTGAGGGCATGTGGGTGTGAGGGCCCCAGGTCTGTGTGGCTTAGAC
CCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGG
GGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCCTCTTGCATGTACGCACTCA
TACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAG
GCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGAACCTAGGCCTGTGGGCAGTGGTCAGG
GCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATG
GGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAG
GTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAAGCCAGGCGAGGAGAGGT
CCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTG
TGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGC
TGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTG
CTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTG
TGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCT
GTGGGTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGGATCTG
GAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCG
GGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCC
ACTCACACCAGCATACTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTATC
TCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGAA
CACATGCCTTGCCGGGTCTTGCCTGCCTGCCCTGGCCTGGCCTTGCCTTGCCTTGCTTTG
CCTTGCCTTGCCTTGCCTTGCCTCGCCTCGCATCGCCAAGCCCTGCATAGCCTTACCGAG
TTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCACTCCC
ACTCCCACTCGCACTCACAGTCCGTCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAA
GGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAG
GGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGCCGCCTTG
TGGTGGCCTGCATGGCCTCACTCTCTAGATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved