Erinaceus_europaeus Locus Mono:147:SNORD64
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:147:SNORD64
Erinaceus_europaeus
Mono:147:SNORD64
scaffold_303766
SNORD64
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGAAACTTCCCTTATTCTTTCTACCCCTAGAAGTATGGACCAAAATTCATT
TTGGCATGTAGAATGTAGAAGGTCTGATTTCTATAATTGTTTCTCCACTGGACATAGACA
TTGTCAGTTCAGTCCATACTCCTAGCCTGGGTCCTTGCATAGTTTTGCCACTGCCATTTT
ACTTTTCAATCCACATCCACTTCTGAATTAATGCATTTGTTCTGGTGTAATAGGCTATTT
TTTTCTTTCTTTTTTTCTGCCTCCAGAGGTACAACTGCCCCTGGTGCCTGCACTACGAAT
CCACTGCCCCTGGAGGCCATTTTTCCCCTTTTGTTGCCCTTGTTATTATTATTGTCACTG
TTGGATAGGACAGAAAGAAATTAAGAGGAGGGAGACAGAGAAGGATGAAGACCCTTTTCA
CTGCTTGTGAAGCACCTCCCTGCAGTTGGGGTGCATGGACTCAAACTGGGATCCTTATGC
TTTGTGCCATGTGCCCTTAACCCTCTTTGCTAATGCCTGACCCCTGGCTATTTTCTGTTT
ATGTACCCAAAAATCTCATTGTTAATCTAGCCACAGACGGATAAGAATCTTACTATTTTT
TTAGTTGTGATTTTTTTGATATTGAGGTAAATATTCATTCTCTCATGCCTGGATATATCC
AGTAAAGTTGTACTAGTCATTGAATAAATACTACCTTGGCTGGATTTATGATGAGCTATG
TTTACTGAGCATGATGAAATGAAGCTTGATATGAGAACTCTGAGGTCCCAGTACAAGTGT
TAGTTCAAAGATTTTTGGGACACATAATTGCTTGAATGTATGTCCCTATGTTACCAATTT
TATAAGTTATTTTTTCATATTAACATTGTAAAGAGCTGGAGATTTTTCAAATGAAACTAG
GTTTCTAACTAGTGATGTTTTATTTTCAGCATCCTGTCTTTCCCCTCATTTTTATCTTAT
TTTCGAATTATATTCCAGATACATTTTTTGGCCTTTTCTCTAATTTTTTTAATTTGGTAA
AAACTTAATAGTGATTACATTAAATCCATATAAGTCTCTGGGTGAAATAGTCATGTTTTT
TGAGATAGTCGCTTTAATACACTGTATTAATCCAACCCATGAATAACTATTGTGTCTTTT
TCTACAGTTAAGTGACTACTTAACATTACTTTTATTTTTTGTTTGAATCTTTGTTTTTTA
ATATTGATTTACAGAACTATAAGATAAAAATAGGGTTATAGTTCCATACCATTTTCACCA
CCAGAGGTCTGTATCCACAGCCCCTTCGTTGGAAACTGCGGTAGATATCCCAAAGTCACA
GATATGGATTGACATTAACTATATATAATCTATTTAAGTATTTGTCCATTTTTTTCAGTC
TTTTCTTCACATTTTTAGTCACACCTTCACCTGTTACTACTTCTGAGCATCCTTTACTCC
CTCTTTCTCTGATAAAAGGAAGCCTGTATGAATCATGAATATATATTAAGAGTCCGTAAA
GTTGTGGTCTGGGAGGTGGCACAGATTGTTTAGCATAAAGTCATTAGGGAAATTGGAAAG
ATGGTTGTTGTACATAGTAAATTTAATAAAGATTTATGTAACTTATCTTTAGTTATTGGA
TAGAGAGCCAAAAATTAGAGGGAAAGGAGAGATAAAAAGGGTAAGAAGAGATACATATGC
AGCACTGCTTCATCATTTTCAAAGCATTCTCCTGGAGTCAAACTGGGGACTTTGCACACT
GTAACATGTACTCAGCCAGGTGCACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved