Erinaceus_europaeus Locus Mono:446:SNORA62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:446:SNORA62
Erinaceus_europaeus
Mono:446:SNORA62
GeneScaffold_6668
SNORA62
1001..1150
2150
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAGCTGAATTTAGAAAGAATTA
AGGGGGGGGGATTCAACTTTCAGCTTGAGAGTAACAGACCTAAGCTTAGATGTGTGATAG
GTGCTGGGCAGGGTCGAGCGGGGCGAGGAGGAGGAGCAGCACGTGCACACCATTAAAGCT
CAGGGTGGAGGCCGGTTCTGGCCTGTGAACTTCTGAGTGTCGGAGGTGTGCTACAGCAAC
GGCAGGGTTTCGCTAACACCAGGAGAGCTCGGCTCTATGACTGGAGTTTGCTAGTGCTCT
CTGCCACATTCAGCTGCTCAGAGGAGTGTGCGTCGCAGCACCTGGCCAGGGGTTGAGTGT
CCTGCTGTCTCCTAGGCATCTACATCATCAACTTGAAGAGGACCTGGGAGAAGCTGCTGC
TGGCCGCGCGCGCTATTGTTGCCATAGAGAATCCAGCTGACGTCAGTGTGATCTCTTCCA
GGAACACTGGCCAGGTGTGCAGGGCCTGTGTGTTGGGGTGAAGGACCTCCCCGTTGGAGT
TTCCAGCTCCCCACCTGCAGGGGAGCTGGACAGGCAGTGAAGCAGGTCTGCAGGTGTCTT
ACCTTTCTCCCCCTGTCTTCCCCTCCTCTCCATTTCTCTGTCCTACCCAACAAGGACGCC
AGTAACAATAACAACTACAATAATAAAAGGGCAACAAAAGGAAAAGTGAGGGAGCAACAG
GAACCCTGATGGTTCACATGTCGTTCAGTCTCACGGATGATGTATGCGCACCTCAGCTTT
ACACGTCACTTCGTGCCGCTGACCATCCGAGAGCTGATGGATTCATGACATTCTGTAGCT
AAAGCAGAGCTTAATTTAACGTGTCTTTTGCAAAGGTCTAAGGGAGGCCAGTTGTAAGGC
AAATTAATCCTTTTGGTCTTCTGTTGACATGCTTTTCTGTTGAAGATAATGGGGATCTTG
AGGGTTGGCTTACAAGGTTTCAAGATTTCATCCCATTTCTGATTAAAATAGTTTGGCTTG
GATTTTTTTATATGTGACAAATTACTGCTCTAGAAAACGTACTGGCTGTCCATCTAGATT
GGTCTAGGTGATGTTTGGGGCTTAAGACAAAGCAGAAGGGCCCTCACTTGGATCTCCTCT
TTTGTGAGTGTGGTTAGTAGGTTACAAGACTAAGATTACAATGTATTAGTTCACCAAAAT
TCTGTGTCCTCACCTTCCTGCCTCCCAAAGATAACCATCATAATTCTCACAAGTCTATGA
AAGTTAGCTTTTAATCTCTAGAAAAGCAATTTTACCTCTTAATAGAAAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved