Erinaceus_europaeus Locus Mono:338:SNORA75
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:338:SNORA75
Erinaceus_europaeus
Mono:338:SNORA75
scaffold_283473
SNORA75
1001..1132
2132
GAGTTCAGAGTTTCTGATTAAGGTGGATGGTTTTGATCAAAGTGTTCTCATTTCCCCAG
TGGACTAAAGTGAGACTATTAATTTTTCAGCCTCAATCTACCCTGTCTTGAAACTTATGA
AAATTGATGACACAATAGTTTTGTAATGCCAAGTGACAAAATGGGAACTTTACTAATGGT
TTTTGTTGTTTTCACTTAACTGGATAAATGTGCCTGCCAGTCTTACCTAATTCATCATTC
CAGCACAGTTTCAGATTCTGAAAATTAAATTATTTTGGCCCACAGAGTCCAGCCTCGCCT
ACCTTTCCTACATCTTGTATGCTTGTTGCGTTTCCTCTCTGTTTGTATTGTTTCTTTTAG
TTTATTGGATATGGTTAAATATTATTGAGAATTTTAATTTTTATTATTTATTTATTATTG
GATACAGACAGAGAGAAATTGAGAAGGGAGGGGAAGATAGAGAGGAAAAGAGACAAAGAG
ATACCAGCAGCCCTGCTTCACCACTCATGAAGCTTTCACCCTGCCAGTGGGGACCAGGGG
CTTAAACCCGGGTCCTTGTGCACTGTAGTGTATATACTCAACCAGGTGCCCCACCACCTG
GCCCCTTGTTGAGAATTTTATATGTAACTGTACTCAGATAAAAGGGCAAGTGGAGCTTCA
TTACAGAGCCCACAACTAATGTCCTTGAAGTTCTAGAAGAATCTATAGAATGTTTTCCCC
TTGGGGATTTCTCTAAAATTCTCATTTCTCTTAAATGACTCAGACTCTCTCGAGGTACTC
CAGTGTTTAGGACAGGAGGTGTGTTTTATGCTCCTGCTAGATGATAAATGCAAAGATGAT
GCATCTCATTATTTAAGACATGTTTTATTAGTCGGTCAAAATGATTTACAGAATATGCTG
TGAACTAACTATGTGCAATGAAGTAAAAAATTTAAGGCATAGAATCTTCTTTCAAAAGTG
TATGTTATGAGAAAGACAAAGGTACTTTAAAAAATATAGGAGTCTTTTCATTGAGCACCT
TTCTCTTGATTGGTGGCAGTGTATGGATTCATGTGAAAAAAAAATTCAGAGAATGAGCAT
TCTTTTGCTTCCTGTCTTCACAGAAGTGTAGTCTGCTATTTTATGAGACAATGTGTTCAA
GCTACCAGTAAAATTAGTTTCAGCTTTCCATAATGATCTACTCTGTACCTTGAATCTCTT
TATTTTATGTTTTCTGTTTTTTTTTTTTTTAAATAAATCACTTTATTCAGATTAACTCAT
AAACAACATCACAAAAAGCTGGATCAAGGAAGCCACAGGAGCATGTTCCAGCCCCAAACT
GAGATAAGATACTCCCTTCCATTGCCAGCCTGAAACAAAGTGGTTATTAATGATCTACAA
TAGGTTAAACTTTGCATTTCAATTATTTTAGTTTCATGCTAAATTAACGTGATGAGAGGT
GATTTTTCATGTCTTCAATTTGAACATCTTGCTTAGGACAATCCATTTGCAAACCTGCAT
TGCTTCAGCACCTCGCTGAAACCCTCACAGAGCTTCAGGTCACTCTGATTCTGGGCACAC
TCCAGAAACTGCTTCATCTCATAGTGGCATGGGCCAAACTGCTGCTGCTGCTGCTGCACG
GGTTGGGCTCCCTGAGGCTCCTGGTAAGTGATGTCGGGCCTAGTGGGCTCAGCATTGCTC
CCTCCACTGAAGCCTCCAGTGAGGGCGTGGCCTATGGTGTGCCCCACGGCGGAGCCCACA
GCCACGCCAGCTGCAGTGCTTGCCATCTGGGCCATGAGGCCGGGCTGTCGGGGAGCGGCG
GCTGGCAAACCAACAGCGGCTGGTGGAGCTGCAGCTGGGGGCTGAGCTGCTGGCGCGGGC
CGAGGGGCAGCCCTCATCTGCGGTGCCCGGCTGGCTGGAGGGGCCATGCGGGAGGTGCGG
CTTCGGCTTCCACGCGGCATCTCGACGGCTCCGCGGCTCCGGGTCCACAAGTGCGAAACT
CCTATTTTATGTTTTCAAATAAGACTTTATGGAATTCCCTATCCAAGATGTGCTTTGTTT
ATAATGTACTCTGGGCTTTAAATATATATATATATATGCAAAGATGCCCCTGTATGAGTA
CTAGACCTCACCTTCAGTAAAAGCTAGGAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved