Erinaceus_europaeus Locus Mono:449:SNORA32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:449:SNORA32
Erinaceus_europaeus
Mono:449:SNORA32
GeneScaffold_3135
SNORA32
1001..1115
2115
AAATCCTTCCATGCCACTTGTTTTCCCTAAAAAAGATGAACATGTTCATCATTTAACAA
GTTGCCTTGACTATCAACCCTGAAAATGAATTCAGCAAATGCCTGAAGTTTGCAGGGATC
TTTAGTGATATGGATAGTTCCAAACAAAATCACTCCTTTCTTAGAAGCACTCATGATACC
TTTACCACTCTACAAACTTACTGACAACTTAAAGTGATTTGTTTACTCCTCAACATCCAA
GGTGAGGAATTGAGTCTAGATAATTATAGTTCCTACTCTCCTTCCCATCAAATATATTTT
TTCTGGGAAGATTGGCAAAAATAATTATAGTTGTTGGTAATTGTGTATGTACAAATTTCT
GTTTTCTGTAAAACATTGTACCTCCCACCTAAGTCCTTCTCCACCATTGTGCACCAGGTT
ATGAACCCCCAAGCCTTCCACCCACGAGTCCTTTATTTTGGTGCAATTCACTAACTTTTT
TCTCATAAACAATCCCATTTCTGTATTAATAAATTTATATTGAGCAGGGTGCTGCCACCT
TGTGGTAATAAGGTATCATTGCATTCCTCAGGACATGAACACTAGGAATTTCCCACTCAA
AACAACAGAAAGGAACAGTGCAGAAAGGGGACCTCAAGCTATTGCAGTTAAAACTTGGCT
CAGACATGATAGGTGAAGTGATGTGATACAGCCTAACTGAGGAGAGTTGTCTGATGGGAA
ACTGACTTCTTGCTATGTTATTTTTAAATGTGGACATTTAAAATGTTAATCTTAGTTAAC
TTAAAGGACATAAGGGTGGGGGTAGATAGCATAGTGGTTATGCAAAGAAACTCTCATGCA
TGAGGCTCCAAAGTCCCAGATTCAATCATATGCATCACCATAAACCAGGGCTGAGCAGTG
CTCTGGTAAAAAAAATAAAAAAAGAAAGAAAGAAAGAAAGAAAAAAGAAAAAGAAAGAAA
AAGAAAATGTAGAATCTTTGATGAATTAAAAAATAAATAAAAGGAAATGTACTTTTAGAA
TATGGTTTCTCATTTTTTGTGGACATGACCTTAAAAACATGCCCACTAGGTTTATTCTGG
GCTACATTGGTACCATTCAGCATTGTGGGAACATCTTGTTAATGAAAATAGTAATAATAA
TAATAAAGTAAATGTAAGAATAAAAGATTTAATTAGTACTCCCTATGTTTCCCCAGATGT
CTGAGGTCAATGCACTGTCTTTCATTCTTAGTGTTATCATCGGTAGCATCTGGAATGCTC
AAATTGTATCTTTTCCTATAAACATTCACCTTAGTTTAGTTACTGAGCTATACATTCTGA
ATCAGTAGTGCTAACTTAATGTGTGTGTGTGTGTGTGTTTAAGATTTGATTATTTGTCAA
TGAGAGAGTGGTGAAGAGAGAGATACAGAGCATCACTCTGGCACATGTGATGCGGGAGTT
GATCTTTGGACTTCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAGGTGTCTATCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCTCT
CTCCATTTCTCTCTGTCCTATCTAACAAGGATGGCATCAACAATAAAAAAAAAAAAAAAC
TTTTCCTTTGCACTGATTACTCTTTTAAATATTCAGCTTTTCATTTAAATTGAACTAAGA
CAATAAACTACTAAACTGAATATTTTCAGTAGCATCTTATGGAGCTAGGAATAAATAATA
TGACATGAAAGTCTGCCTTCCATTTTATTGCTAAAGAATGGCTCACTGCTTTTTTAATTT
AATTTATTTAGAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved