Erinaceus_europaeus Locus Poly:4:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:4:snosnR60_Z15
Erinaceus_europaeus
Poly:4:snosnR60_Z15
scaffold_271634
SNORD78
1001..1064
1829
TGTCCTGTTACAGTTTGTAATTTACCGTAACAAGCCTGTATGATGATAGACGAATACTG
ACTGAACCATGAGGTTTGATTAGCTCTACCTGATCGGGCAACTGTTAATATGAGGAATAG
AAAAGGGATTTTTTTGTGTGTGTGATTGTAAAATAATTCTCCTCCTAGGTGGTCTTGAAT
CCGGTATCACTGCATTATCCATGTTAGGTAAGGACTAACAATCAGTCTCCAATTGCTAAT
AAGAATGTAATGAGTTTAACTACCAAACTAATAAGTTTACTAGTTTGGTAACTGCTTTAT
TCAATGCCAAATGGGGTTTTTGTAATGATGTTGACCAAATGTCTGACCTGAAATAAGTAT
GTAGACAAGTTAACACTGAAGAACCCTATCATGAGACTGCTAAGATTTAATAGTTAATAT
AAAACATTAACAAAAAATTGTGTTCCTAGGTGCAGACATGGGAAACTTGCATAAAGAAAG
GTATGTATATAATTAGTATTATCTCTTTAATAAGGAATATGCTGTTAATGATGAATTTTT
AAATAGATGGGAATCTCTCTGAAGAAGAGTGATGATTACAAAACTCTGAAACAGTGCATC
AAAACTGTAAAAAATCTATCTGTTACTACCTTGTATTAAATATGCATGCTTTTTTAGATG
CGGAAACATGCTGACTACAAGACACTGGACAATGGAGATTAATAAGCAAAGGTATTCCAA
GTTTGGTTTTTCTGCCACATGGTTAAAAGCCGATACAATGATGATAACATAGTTCAGCAG
ACAAAATGGTGGTGAGCACACATGTCTTTCGCTCCTATCTGATGTATCTGGCTCTAACCA
AAGAGAAATGTGATTGTCAGTGTTGAGCAGTTTTGATAGCCATAGCTTAACATTTGCTAG
AAAATGTAACTGGAGAGGGGTAGAAGGCATACGGGTTGGGCAGCTAATAGCCGTACCTGA
GGCTCTAAGGTTCCAGGCTCAATCCCCAGTACCACTGCAAACTATGAGCATTACTCATAA
AGTGTTCCAGGATGTGGAGCAGTGGATAAAAGCATTGGATTCTCAAGCATGAGTACCAGA
GTGATGTCTGGTTCTTTTTCATATCTTTCTCATTAATCTTTTAAAAATACTTTAAAAGAA
ATGATTAAAAAGGGTGGGGATAGATAGCATAATGGTTATGTAAAGAGACTGTCATGCCTG
AGGCTCCAAAGTCCCAAGTTCAATTCCCCACACACCACCATAAGCTAGAGCTGAGCAGTA
CTCTGGTAAAAAAAAAAAACTTGGCTAAAAATGATAAAAGATCCTGAATGTGGGGGGGTG
GTAGTGGAGCACACATTAAAATGCCCAAGGTTCCAGGTTCAATCCCCTGCTTCCCACCTG
CAAGAGGAAAGCTTCACAAGTGGTGAGGCAGGGCTGGCTGCAAGTGTCTGTCTGTCACCC
CTTCTGGCTATCTATCCAATAAGATATAAGGAAAATAAGGCAAAAAGGGAAAGTATTTAA
AACTTAAAAAAAATTTAAAAACAAATCCCAACTATTCAGAGGGTTAGGTTTACTTCAGGA
ATGTGTTGTCCCAAGCAAGTAATATTTTCTATTTTCATGACAGGCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved