Erinaceus_europaeus Locus Mono:248:SNORA3
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:248:SNORA3
Erinaceus_europaeus
Mono:248:SNORA3
scaffold_327026
SNORA3
1001..1127
1976
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGATCCTGGTTATATCCCCCCGGCT
CCCCACCTGAAGGGAGGTCCCCTCACCAGGCGGTTGAAGCAGGTCTATAAGTGTCTGTCT
TTCTCTTCCCCTTCTCTCTCCATTTCCCTCTCTCTTATCTAATAATGACAACATCAATAA
CAACAACAATAATAACTACAACAATAAAAAAAAACAAGGGCAACAAAAGGGAAAATAGAT
AAATATAAAATTTAAAAAATTAAAACAAACAAACAAACAAGAAAGATATGGTACATAATG
GAATACTACTTGGGTATTAAGAAGTCACTTCCTTCACCTTCATCTTGGGTGGAGCTTGAA
GAAATCATATTAAGTGAGATATGCCAAAAAGACTAGGATGCGGCGAGGCTAGAGTCTTGC
CAGGGCATGGCGTTGCCCCGGCGTGCTGGAGTCTTCGGAGAGCAGCCGCTGGCCTTATTC
GCTGGCTGTGGCCCCATGGCCGATCCAGTCACCAGGCCAGGGACAGGCAGACAGGGAAAA
AAAAAGACTAGGATGAATATGAAATTATCTTGCTCATGGGCAGCACTTAGGAAACAAGAA
CATAAAGAGGAAACACAAACTAAAAAAGACAGACACCTGCAGACCTGCTTCACCGCCTGT
GAAGGGACTCCCGTGCAGGTGGGGAGCCGGGGGCTCGAACCAGGATCCTTTTGCCGGTCC
TTACACTTTGCGCCACCTGTGCTTAACCCGCTGCGCTACCGCCCGACTCCTGTAGTTCTT
TTTCCTTATTTCTTGTTTAGAAATTCTCACCAATTGAAAGATATCCATTCAATTTTCCAT
CCAAATTCTATAATTCATAGACACAACAATCATTTTTAACCAGTTCTGCTAAGCTCTTGC
ATTACATGGCCCATGTTTACTGTACTTACTATTATATTTGGAAGTGTGAGTATTTGCTAC
ATATTGCCTAGGAGAAAATTAATAAGGTATTATTGGAAAACAAAAGTAGCATTTGCTGTC
TGTACAATTCAAAGTTAAACATACACACAGACACACTGGAAACACTTTCAATTCACAAGC
TGCAGGGTGTCTGAAGCTCAAATCATAACTGAATTTCGTGGCTTTTAACTTTATCTTGGA
TAATGAATATTCAGAACTCAGATATAATAATTATAAAGTATATTAAATAATTACCTAAAC
TAAGCACAAATTGATTTAACTCCCCTGTGGCCTAAACGAATGCTTCAGTGTACATATAAT
CCTTCATAAAAATAACTGTTGTATGAAAAGGAAAGATTTAAAAATGAAATGTTAAGTAAA
TTATCAAAATCAATTTAAGAATGGATAAACATGAAGGATGATAAATGATATAGTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved