Erinaceus_europaeus Locus Mono:437:SNORD70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:437:SNORD70
Erinaceus_europaeus
Mono:437:SNORD70
GeneScaffold_1959
SNORD70
1001..1088
2088
TACAGAAGCCAGACCTCCCACCTTATGTACCCCATAATGATCCTGGGTCCATACTCCCA
GAGGGATAAGGAATAGGAAAGCTATCAGAAGAGGGGANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTA
GAGCCTGAGGCTCCAAGGTCCCAGATTAAATCCCCACACCACTATAAACCAGAGCTGAGC
AATGGTCTGGGGGAAAAAAAGATTTTTTTTAATAAAGAGAAATGAACCCATGATGTGTAA
GTTGGTAAAGGGATTGTGGTGAGGCAGAGTAGGATGAAATTAATTTTCCCATTACATTAT
TAAGTGTATTAGTGGGACCAACCAATTGTTTTTTGACCAGGTAAGAGAATCTTAAAGTAG
CACTGTTTTTAGACACAATAGACTGGCTTGATTTAGTCTGAATCGTTGTTGTCAATGATG
TAGTCATGTTGGAACTGAATCTTAAGTGATCTGACATATATTCGTCACTACCACTGAGAC
AGCAATGTATTCAATGATTATTCTGCACTTCAGTATATGGGGAGGGAGGTCAGATAAGGG
TAAAAAGAATCACACTTGGCAGCAAACTCCTTTTTTTCCTCCTGCAGAAAGCAGAGAAAG
GGGAGTCAGGTGGTAGTGCAACCCATTAAGCACACATGGCACGAAGCGCAAGTACTAGCG
TGAGGTTCCTGGTTTGAGCCCTAGCTCTCCACCTGTAGGGGAGTCACTTCACAGGCGGTG
AAGCAGGTCTGTAGGTGTCTTTGTCTTCCCCTCCTCTCCATTTCTCTCTGTCCTATCTAA
CAATGACGACATCAGTAATTACAACAACAGTAAAAAAACAAGGGCAACAAAAGGAAAAAT
AAATATATATATAAAATTTTTTTTATTTATTCCCTTTTGTTGCCCCTTGTTGTTTTGTTG
CAGTTATTATTGATGTTGTTATTGTTGGATGGGACAGAGAGAAATGGAGAGAGAGAGGAG
GGGAAGGTGGGGACAGAGCCTGTGAAGCTACTCCCCTGCAGGTGGGGAGCTGGGGGCTCG
AACTGCCATCCTTAAGCCGGTCCTTGGCCCTTTGCGCCTCGTGTGCTTAACCCGCTGCGC
TACCGGATGACTCCCATATAGAATGTTTTTTTTATAAAAGGGAAAGACCATAGCACCAAG
CCTGCCTCCAGATTGGGCTAGCTGCAGTAGGAAATCTTTTCACTGTTTTACCCTTCTCTA
ATCACCACTCACTAGCTCAAAGGAAGAGAAGGCAGGAATATAGAGATGGGGGAGAAAATC
TGACTTTGAGGCCTAGTCCCATATAACGAAAGCTTCCTACATATGTGACTTGCAGAATCA
GTATCTTCTCATAACAACTTTTGTTTTTGATTCTAGAGTAAAACTAAAACATTTTGAGAA
ATTCCAGGATACAGCAGAAGCATTGGCAGGTAAAGTCAAAAGCTGGCTATTTGTTTTTTC
AATCTGGAAATTTATTGTCCTTATTTTTATTTTTTTTAATTGTGGGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved