Erinaceus_europaeus Locus Mono:24:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:24:SNORA26
Erinaceus_europaeus
Mono:24:SNORA26
scaffold_278941
SNORA26
1001..1115
1332
CGACACAGAGAAAAATAATCAAGAATTGCTCAACTGGTGATGGCAATTGAACCTGGGAT
CTTGGAACCTCAGGCTCAAAAGTCTTTTGTATAACCATTATGCTATCTCCTCAACCCTTC
TGGTTTCACTTTCAATAAGCGTATCTTACTATGTTAATTATTTCCATTAATTAACAAGAG
ATAACTATCTTTTATTCGTGATATTTATGACCTCCCTCATGCCTTATTAAAGACTGTTGC
AATGATTAAGAGACTAACACAGAAAGGTAAAGTAAATTTCCACAAAGCCCAAAAAAGACA
GCAAAACTCTGAATCCTGTCTGGTGTCACAATTTAACCAGAAAAAAAAAAAAGGAGCAGA
AATAAGAGGAAGAGAAAGGAGGAAGAGGAAGAGGAGGAGACGTAGGGGGATAGGGAGAAG
AATAAGAGGAATCTAATAAACTCAATTAGCTTGACTGAGCGAAAATTTCCAATAGCATCA
GTTAATTTTGGTATGTCAACATTTTGCTAGAATACTTCTATTAGTCAACTTTATCTGATG
TCCACAGTAATAGCAAAATGACTTTATAGTAATAATTATCTCTAAATAATATTTTCTAAT
CTATAAAATTCATTACTCTGAAAATGTGTTTATTATTGCCATAAATATTTCTAGAAAGCC
TTGTGTTTGAAGAATAATGAACTTTAGATTGATTTCTAAAACTGCTATATTTCCACTGCA
TTGTTAATTAGGTTATCTTTAACAAAATTTCCATTCTAGAAATGTATGATTTGCATGTAT
ATTCATGTGGCCAAGGTTGCTTCTGAAAGAATTTCTTTCTAAATTCAGACATGTTTATGA
AACTGCTTGTATCCACCAAGAGACCATAAGCAGACTATAATAAATAGAAACAATTTTAAA
TGCTCCATAAAAATGAAAATTGTCAAGTAGCAATTCTGTATATGGGATTAAGAACATTAC
ATTAGGAAAATATAATTAGAGTTTTCTTAGCAATAATAATAATATGTGGATATAAAGGAA
TTTATATCTATACACAGTAATTTGTTCTAAGCTTTCGGTTAATAACCAGGGTATGACATA
TTGTGCTATTCATATCAATTCAAAGCTTAAAAAGCACAAGTTTTAGATGCCAATATTGAG
AACAATTATTTTGGTGTTCCTTCATATAACAACTATTACAAGTAGTTTAAAGCCTGAAGA
ACAAGAGGGTTGGTGGAAGGATATTCAGGAGGGAAGTCTGTAAAAATGTGCTAGGTAGGG
AGTGGTAGCAGATTTTGAAGAGGTGTGACATCACACTTAATAAAATATGTATAATCTTGA
AATTCTGGTTACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved