Erinaceus_europaeus Locus Mono:490:SNORD24
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:490:SNORD24
Erinaceus_europaeus
Mono:490:SNORD24
GeneScaffold_2929
SNORD24
1001..1079
2079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGGAGAATACCTTTAAACAATGA
AAGGAAGTCAGAAAGAAATTACCACAGATCATCAAAATTGTAACTTTCTAGTTCATGATG
GGATAAATACATCAATACATTTTAAAAGATCATACAAGGTAACAACAGCAACAAGTACCA
GAATCTAAGAATTAGGATTGAAAGAATAATCACAGCTGGGCTAGGCAGTGGCACACTTGG
TTTAGCACACATTACCATGTGCAAGGATCCAGGTTCAAATCCCCAGTCCCTCTCTGTATG
GGAGAGCTTCATAAGCAATACAGCAGTGCTGTGGGTGTTTCTCTTTGTCTCTCCGTCCCT
CCAACTCTCCCTATCACCTTTCCCTCTCAATTTCTCTATCCTGACAAGGAGAAAGAGACA
AACAGAGAGAGACACCACCAGGAATAGTAGATTTGTCATGTAGGCACAAAGCACCAATGA
TTACTTGGTGACAAAGAAAAAGAAGAAAAGGAATGAGGGGAAGGAGGGGGAGAGGAAAGG
AGAGGTAAAAGAGAGGGGGAGGGAGGGATAATCACAACAGAAATCCCTTAAAATATAAAA
AATAAAAGAAAAATTGAAAAGCCAAAATATAAGCGAACTTTGTCAGAAATAGATAAATAA
TGAAGACAAAGAAAATCCAATGTTCATAAAAGAATTGTGTCCCACAGTAATGACAAATTA
TTTGCTACTCTTTATCATAAGATGATGAGAGTTAATACCACCATTATCATAACTGAGTAA
GTACTAGAAGTTCTAACTATATCCTCTTCTGTATTCTGGAGTCAGATTCTTGGAGTGGAA
GAAAAGAGATACAGATGTAGCATAAAAGATGCAGTATAGCAGGTCGGGTGGTAGCGCAGC
AGGCTAAGCACACATGGCGCAAAGTGCAAGGACCAGCATAAGGATCCCGTTGGAGCCCTC
AGCTCCCCACCTGCTGGGGAGTCGCTTCACAGGCGGTGAAGCAGGTCTTGCAGGTGCCTA
TCTTTCTCTCCCCCTCTGTCTTTCCCTCCTTTCTCCATTTCTCTCTGTCCTATCCAACAA
TGACGACATCAATAACAACAATAACTACAACAATAAAACAAGGGCCACAAAAGGGAAAAT
AAATATAAAAAAGATGCAGTATAATAAAAATCCTGCACTCCTACATATGAATAACCATTT
GAATACATGAGATATCTAAAATTATCTGGTTTTAGTTTCTTAGCAAAAAAAAAAAAAGGC
ATGAAAACAGCACAGAAGGCGATGAATAATCCTAATGACAAGAATATAGTCTTAAACATA
TTATTTCCTGGGGGCTGGGCAGTATTGCAGCAGGTTATGGGCACCTTGGCACCAAGCTCA
AGGACCGGCTTAGTATCCCGGGTTCCGATTGGCCTGGCTCCTCACCTTGTAGGGGGGGGT
CCGAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved