Erinaceus_europaeus Locus Poly:13:SNORD78
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:13:SNORD78
Erinaceus_europaeus
Poly:13:SNORD78
GeneScaffold_2622
SNORD78, SNORD78
1001..1064, 2882..2945
3945
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTAAAGGAACTTGCAAATCTCAAAACAAGAAACAAATTA
CCCCATTCCAAAAAATGGGGGGGAGGACATGGACAGAATATTCACCACAGAAGAGATCCC
AAAAGGTCAAGAAAACACATGAAAAATGCTCCAAAGTCTCTGATTGTCAGAGAAAATGCA
AATAAAGACAAACAATGAGATACCCACCTTCACTCCTGTGAGAATGTCATACATCAGAAA
AAGGTAACAGCAGCAAATGTTGGAGAGGGTTGTGGGGTCAAAGGAAGCCTCCTACACTGC
TGGTGGGAATGTAAATTGGTCCAACCTCTGTGGAGAACAGTCTGGAGAACTCTCAGAAGG
CTAGAAATGGACCTACCTTATGATCCTACAATTCCTCTCCTGGGGATATATCCTAAGGAA
CCCAACACACCCATCCAAAAAGATCTGTGTACACATTGTTCTTGGCAGCACAATTTGTAA
TAGCCAAAACTTGGAAGCAACCCAGGTGTCCAACAGATGAGTGGCTGAGCAAGTTGTGGT
ATATATATATATATTACTCAGCTATAAAAAATGGTGACTTCATGTAATGATGTTGACCAA
ATGTCTGACCTGAAATAAGTATGTAGACAAGTTAACACTGAAGAAAAAAAAAAAATGGTG
ACTTCAAATCAAATAATACTGCATCCGCGGATCACAACCTAATCAGTGCGAGTGCCAACC
CTGCATGCTTCACTTCAGACTGTGACCAGAGACTTCAGGTGTGGAAATGACAACCCTTCA
GCTTCATCACTCGGGTGACACCTTTCCTTTCATACATAGTGTTCTCTAATTCCATTCCAG
GTGGTCCACTCCCCAATAAAGTCCCCAAACCTAGATATAGTTCAGGTCCCCTGAGATAGA
GCATAGGTTCACACATGCCCATAAACTAGGGAAAAATATATACCTGAAAGCAGAAGTACA
CAAGAGCATGCAGGGAATACCCCCCAACACTTCATCTGCACTATTCCAGTCTTTAGGTCC
ATGATTGTTCAACAATTTGTTTGGCTTTGTATGTTAACTCTCTTTTCAGCCACCAGGTTC
CGGATACCAGCAAGATGCTGACCAGACTTCCCTGGACAGACGACCCCATCAATGTGTACT
GGAGCTCCGCTTCCTCAGAGCCCCACCCTACTAGGGAAAGAGAGAGGCAGACAGAGAGTA
TGGATCGACCAGTCAACGCTCATGTTCAGCGGGGAAGCAATTATGGAAGCCAGACCTTCC
ACCCTCTGCAACCCACAATGACCCTGGGTCCATGTTCCCAGAGGGATAGAGAGTGGGAAA
GCTATCAGGGGAGGGGATGGGATATGGAGATCGGGTTATGGGAATTGTGCGGAATTGTAC
CCCTCTTATTCTATGGTTTTGTTAATGTCTCCTTTCTTAAATTTAAAAAAAAAAAAAAGA
AAGAAAGAAAAGAAAAAAAATGGTGACTTCACCATTTTCAGCCAATCTTGTACGGACCTT
GAAAATTTTATGTTAAGTGAAATAAGTCAGAAACAGAAGGATGAATATGGGATGATCTCA
CTCTCAGGTCGAAGTTGAAAAACAAGATCAGAAAAGAAAACACAAGTAGAACCTGAACTG
GAATTGGCGTATTGCACCAAAGTAAAAGACTCTGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGAAGACTTAAAGCAAGCATAAACCTATGGGACTACCACTAAGGT
AAAAAGCTTCTGTACAGCAAAAAAAACAACTACCCTTACCAAGAGACCCCTCACAGAATG
GGAGAAGATCTTTACATGCCATACATCAGACATGAGGCTAATAACCAGAATATATAAAGA
ACTTGCAAATCTCAAAAACAAGAAAACAAATAACCCCATCCAAAAATGGGGGGAGGACAT
GGACAGAATATTCACCACAGAAGAGATCCAAAAGGTCAAGAAACACATGAAAAATGCTCC
AAGTCTCTGATTGTCAGAGAAATGCAAATAAAGACAACAATGAGATACCACTTCACTCCT
GTGAGAATGTCATACATCAGAAAAGGTAACAGCAGCAAATGTTGGAGAGGTTGTGGGGTC
AAAGGAAGCCTCCTACACTGCTGGTGGGAATGTAAATTGGTCCAACCTCTGTGGAGAACA
GTCTGGAGAACTCTCAGAAGGCTAGAAATGGACCTACCTTATGATCCTACAATTCCTCTC
CTGGGGATATATCCTAAGGAACCCAACACACCCATCCAAAAAGATCTGTGTACACATTGT
TCTTGGCAGCACAATTTGTAATAGCCAAAACTTGGAAGCAACCCAGGTGTCCAACAGATG
AGTGGCTGAGCAAGTTGTGGTATATATATATATATTACTCAGCTATAAAAAATGGTGACT
TCATGTAATGATGTTGACCAAATGTCTGACCTGAAATAAGTATGTAGACAAGTTAACACT
GAAGAAAAAAAAAAAATGGTGACTTCAAATCAAATAATACTGCATCCGCGGATCACAACC
TAATCAGTGCGAGTGCCAACCCTGCATGCTTCACTTCAGACTGTGACCAGAGACTTCAGG
TGTGGAAATGACAACCCTTCAGCTTCATCACTCGGGTGACACCTTTCCTTTCATACATAG
TGTTCTCTAATTCCATTCCAGGTGGTCCACTCCCCAATAAAGTCCCCAAACCTAGATATA
GTTCAGGTCCCCTGAGATAGAGCATAGGTTCACACATGCCCATAAACTAGGGAAAAATAT
ATACCTGAAAGCAGAAGTACACAAGAGCATGCAGGGAATACCCCCCAACACTTCATCTGC
ACTATTCCAGTCTTTAGGTCCATGATTGTTCAACAATTTGTTTGGCTTTGTATGTTAACT
CTCTTTTCAGCCACCAGGTTCCGGATACCAGCAAGATGCTGACCAGACTTCCCTGGACAG
ACGACCCCATCAATGTGTACTGGAGCTCCGCTTCCTCAGAGCCCCACCCTACTAGGGAAA
GAGAGAGGCAGACAGAGAGTATGGATCGACCAGTCAACGCTCATGTTCAGCGGGGAAGCA
ATTATGGAAGCCAGACCTTCCACCCTCTGCAACCCACATGACCCTGGGTCCATGCTCCCA
GAGGGATAGAGAGTGGGAAAGCTATCAGGGGAGGGGATGGGATATGGAGATCGGGTTATG
GGAATTGTGCGGAATTGTACCCCTCTTATTCTATGGTTTTGTTAATGTCTCCTTTCTTAA
ATTTAAAAAAAAAAAAAAGAAAGAAAGAAAAGAAAAAAAATGGTGACTTCACCATTTTCA
GCCAATCTTGTACGGACCTTGAAAATTTTATGTTAAGTGAAATAAGTCAGAAACAGAAGG
ATGAATATGGGATGATCTCACTCTCAGGTCGAAGTTGAAAAACAAGATCAGAAAAGAAAA
CACAAGTAGAACCTGAACTGGAATTGGCGTATTGCACCAAAGTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved