Erinaceus_europaeus Locus Mono:124:SNORA74
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:124:SNORA74
Erinaceus_europaeus
Mono:124:SNORA74
scaffold_347625
SNORA74
1001..1197
2197
CCTTTTTTCTTTTTTTTAAATTTGTTCACTTACTTTCCCTTTTGTTGCCCTTGTTTTTT
GTTGTAGTTGTTATTGATGTTGTCGTTGGATTGAACAGAGAGAAATGGAGAGAGGAGGGG
AAGAAAGGGTAAGAGAAATAGACACCTGCAGACCTACACTGCCTGTGAAGCAGCTCCCCT
CCAGGTGGGGAGCCAGGTGCTCGAACTGGAATCCTTACGCAGGTCCTTATGTGTGCTTAA
CCCTCTTTCTTCCTTCCTTTTTTTTTTAATTGGATAGCACAGAGAAATCAAGAGAGACAC
CTGCAGATCTGCTTCACACTTTGCAAAGCTCTCCCCTGCCCCACAGGTGGGAAGCCAGGG
GCTTGACCAATCAGGATCCCTGTAGAGTCCCTCCACTTACCACTGGGTGCAATACTGTCT
GCCCCCTGTGAAGTATTTTGCTAAGTTAATACCCTATCGGCCAGCAAATTAGTGTCCTAT
GTGGGAAATTTTTTTAGAATGCTAATTTTCTGGGGAGATGCTTCTCAGTTCTGGACAGAA
CTTGGCACTTAGGATGATGATGGGGCTTGCCCAACTTAGACACCTGCAGCCCTGCTTACA
TCACTGGGGAAGTTTCCCCCTGCGTGTGGAGACTAGGCACTTGAACCAGGGTCCTTGCAC
ATTGTAATGTGTGTTTAACCAGATGTGCCACCACCTGGCCTCCTTTTTTTTTTGTCAACT
ATTAAACAGTAAAATCTTACTTCTTTTAGGGTGACTGAAAGTGGGGGTCCTGGGCCCTTC
TGAAGAGAGGAAATTCATGGCAGATTGAACAGAGTGTATGGAGCTTCCAGGTAAGTACCG
CTAACATCCTGAGTGTTGGACAAAATGGCTGAGGAGCTGGGAAAAGGATTCTTGATTCCC
ATTTGTTAAAAAGGGGTTTGGATATAAGTGGTTTCAGGCTTCTATTTGATAGGATTGAAT
TCCCAGGGATACCTGTACTCATGCCTTCCACTTGGGAATCACCCAGTGGTTGTCAGCTAC
CAAGGCTAATGTGCCTTGGGTGGTGTTACACTGCTGGAAGAGCAATCATTGCCTTGAATG
ACGTATGAGTCTGAGCACTGTTTTAGTGTGATGACAGTACCTTGGGGCAATGCCTTGCAC
CTCTTGAGAGTGGAATGACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACATATT
TCTTATTAAAATGCGCTACCTTAGAAACAGTGTGACATTCCTTTCCTATTTGAATCCTAG
ATGCCTTCACCTGAGTGAGACCTTCGTCATCAAGACCTTTGATGCCTGACAGCCCTGCAT
AGCACATGTATGTATGTAGTTGTGAAGGTCTGCATTAACTTGCATCATCTCAGATGGGTG
GGATGAAATAGAGTAGTTACCTATCTCTAGTTCGTGACACAGAACTCTTAAAAATCACTG
AAATTCAAAAGCACTAAGACCATCTGTTATTGATTACAGCTTCTATACTTCATGAAATTT
CCTAAGTGAATGGAACATTCTGTTAAGTTGGGGCTGGTAAGCAGAAAGATCGTTTTGGAT
ATTCATCCTATTTTCCAAAGAAAAAGGGGGCCTGGAAATGAGGTTGATAATACAGTTCTT
AAGAAGTATTTGTGTGCAGTGAGTCAGGGTCAGGCCCCTGGTCCCACCTGCAAGTCGGAA
GCTTCCTGTGGTTAAGCAGGACAGCAAGTGTCTCTTTGGTCTCTATGCAGTAAATTAATA
AATAGTAAAAATTTCACCTTTGAACTAGTAAGACAAAAACATTTAAGCCGGTGATGGCAG
TTTGGTGCTGTGGATTATACCTGGCACTTCAGAGCCTCAGGTAAAGTTTTGCATAACCGT
TGTGCTGTCTCCCCAGCCCTTATGTTTTTAAAAAAAACATGAGAAAGGGAGAAACCAAAT
TTTCAGTGTCATCTGGTATATGGGGTGCTGGGATGTATTTACAAGATTCAACCACTGTAC
AACTTCCCAGGCCAGTGTCTCAGATTTTTAATCAAGAAAAAAAATACCCAAAGGGATAAA
TTATGCAGTCCCTAAAGGGACACAAAAAGGAGGCTCTGTGCCTAGGAATTCACACAAAGG
AAAACAACCTGGTAAGAGCAACTAATTAAGACCATAAAAGAATGACAATGGCTCCAGGTA
ATCTTGTCGCTTAATTAGGGCTTTATGAACAGCTCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved