Erinaceus_europaeus Locus Mono:292:SNORA38
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:292:SNORA38
Erinaceus_europaeus
Mono:292:SNORA38
scaffold_298787
SNORA38
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAAGCCTTTTGGGGAGGA
AAAGGGCTAGAGGTCTCCTTGGGCCAAACTGTTCACCTCTCCTATCCACTGCTTTCCCCT
CGCCTCCGTATCTTAAAAGGTTCTCTTCCCAGGATGGATTGGGGGCTGGGACGAACATGT
CCAATCCCCCAGCTCTTCCGGCCCCTGTGTTTTTTTTTTACCCATGAGAATACCTGTCCG
GGGTACACTTATAAAGGGTTTTTTATTTTTGTAGATTGAAAATAAAGTGTGACATATGAC
CAATTTCCATTGTGGGGGGGGGGGGCGGGGGAAAAAACAGAAGTAGAACCTGAAATGGAA
TTGGCGTATTGCACCAAAGTAAAAGACTCTGGGGTGGGTGGGTGGGGAGAATACAGGTCC
ATGAAGGATGATGAATGACATAGTGGGGGTTGTATTGTTAAATGGGAAACTGGGGAATGT
TATGCATGTACAAACTATTGTACTTACTGTTGAATGTAAAACATTAATCCCCCAATAAAA
ATAAAAAAAAAAGAAATTGTACCTCTGTGTTAGCCACTGTAATATAAACCATTAACCAAC
TCCCAATAAAATTATTTTTTTTAATGTGACTTGCACAGCTCCTCACATAAAAGGAATAAA
GCTTAACTATCAAAACTCTCCAAGGACTCCCCAACAAGGATAAATTCATTGACAAAAAAA
GCAAAAATATGGTGGATTAAGACTAAGGATGTATGCTTGTACCCTCCTACAAAGGCTTGT
CTGTGGCTCTCAGTCTTTATAGACATATAAGAAGGAGAGATAAAGAAATGTGGACTTGGA
GAAGTCTTGGGCCAGCTTACTCTATGCATGCTTAAGATCAACTTTCCCACAAAGGGGTGT
GTGTGTATGTGTGTGTGTGTGTGCTTGTGATATATTTTTTAAATTTTTTATTATCTTTAA
AAAATTTTTTATTATCTTTATTTAATCACTGGTCAGAAGCAGCCAGAAATCTAGAGGAAT
GGGGGGATAGAGATACAGAGAGACAGAGAGACACCTGCATCCCCGCTTTACCATTTGTGA
CTTTCCCCCTGCAGATGGAGACTGGGGGCTTGAACGCGGGTCCTTGCACATTGTAACGTG
TACTCAACCAGGTGCTCCACCACCTGGCCCCAATTTTTTTTAACTATCTTTATTTATTTA
TTGGATAGAGACAGTCACAAATTGAGAGGGAAGGAGGAGATCAAGAGGGAAAGGGAGAGA
GAGAGAAACCTGCAGTCCTGGGTTATAACATTATAACATGTACGCTCAACCAGGTGTGCC
ACCACCCAGCCCCATGTGCTTGTGATCTTAAGGAGGAAATTGGCACTGTGGCAGTGAGTT
TTCATAAACAAGAGAGTCAAATACGGCAAAGCCTGTTTTCCACAGAGAAAAATAAAAACA
AACAAACAAACAAAATTTGTCCCCAAAACCTTACCTTTAATTACACCACTAACCAATCCA
GGAATGCCCTGGATTGAAGTGATATTATTGTGAACAAAGTATTCATCACAGGTGACATTG
AAAAATTGACTTGAATTACAGAAGAAGCCCCATAACTTAGTTGGTACTGTCATGTTGTTA
AGTTCTTTAGTCTTAGAGCAAACATCAATATGTCGTGATGAAAGGGTACGGTTACCCAGC
ATGCAGACCCTAGGTGAAAACAAATGGGGGAAGAAGAATGGGGAAAAAAAATTACTTACG
AAAGTATGTTAAAAATAGGTTAGTAAGGGGATTGGGTGGCATTGCACCTAGTTCAGTGCA
CAAGGACCTGGGTTCAAATCTCCCGTCCTCACTTGCAGGGGAAGCTACACAACCTGTTCA
GCGGTGCTGTGGGTCTGTCTCCCCCACCCCCGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved