Erinaceus_europaeus Locus Mono:116:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:116:SNORD116
Erinaceus_europaeus
Mono:116:SNORD116
scaffold_63214
SNORD116
1001..1098
2098
TCATCCGGCCTTTGCTTCCTGCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTGTGAGG
GCATGCGGGTGTGAGGGCCCCAGGTCTGTGTGGCTTAGACCCAAGGCTTGCAGACTGTTT
GTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCCCGC
CAGCAGCATTCCTGCATTCCCTCTTGCATGCACGCACTCATACACGCCAGGCACCCTCAC
CAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAG
GCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGG
GCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATG
GGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAG
GTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGT
CCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTG
TGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGC
TGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCAGCAGGGGAGGCTG
CTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTG
TGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCT
GTGGGTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGGATCTG
GAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCG
GGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCC
ACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTAT
CTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGG
ACACATGCCTTGCCGGGTCTTGCCTGGCCTGCCCTGGCCTGGCCTGGCCTGGCCTGGCCT
TGCCTTGCCTTGCTTTGCCTTGCCTTGCCTTGCCTCGCCTCGCATCGCCTAGCCCTGCAT
AGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCAC
ACACCCACTCCCACTCCCACTCCCACTCGCACTCACAGTCCGTCAAGCAGCCATGTCAGG
CAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCT
GGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGG
TCTGTGCTGGCCGCCTTGTGGTGGCCTGCATGGCCTCACTCTCTAGAGCCCTCTGGTTTG
TAGGCCTGGGGCCGGGCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCAG
CCTGCAGGGTCTCCACCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGGG
GAAGTTGGCGAAGGCTCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGTA
CCTTCATGAGGCAGAGGGAGTTCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGA
CAGAGCAAGAGTTAGACAGTTGGACTGGGTCCTGGGATCGGGGGTGTGGCCATAGTCCTG
ACTAGTGCTCAGGCAGCCTATGGGAGAGGGAGGCTGGGCCTGGGCATGGGCATCGTCCTG
GGCCAGGGCCTATGCCAGGGCCCAGGTCGCGCTTGGTCCCCTGATTTGGGGGCAGCCTGA
GTTGCAGGCCCCATTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGGT
CGCACAGTGGTGATGGGGAGGCCCTTGCATGGGGTATTTGGGCCCCTGGAGGGCCAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved