Erinaceus_europaeus Locus Mono:23:SNORA44
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:23:SNORA44
Erinaceus_europaeus
Mono:23:SNORA44
scaffold_340154
SNORA44
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTTTATTATTTTTATTTGTCTACAATTTCTAAATATCTAGTAGTA
GCCATGGAATCTCCAACTGCATATGCAAGAAGAGTCTAGAGAGATTATGACAGCACAAAT
CAGCATAATCCCTGTAGCTGCCTCTAAACTTTCCTATATTTCAGAACATGAGCTTTGATG
ACTTTCTCTTGAATTTTCACCAGTTTCTGTTAGAATGAGAATAGGAAATTTAAAATTTAT
TCAGCATGTTTCCTAGCAGTGTCAGATACCGAAGACTGTGACAGAGACCGGTTGCTGGAG
TTTTGCTTTTTAGTAAGATCTGTTACCAGTAATGTTTCCTCATCTGCTCTTAGAATGTGA
GCAGCAATATAGAGGAGAATCAAGAGGAACCAAGCTGAGACAAGGAAAAGTGTGGCAGTG
GCCATAGTCCTGAGGGTCGAAGATTGATCCCAAGCATCCCATTTCTCTATCCTCCAGGGT
TATTGCTGTGAATCCACTGCTCCTGGAAGCCATTTTCCCCATTTTGTTGCCCTGTTGGAC
TTGTAGTTTTTATTATTATCATTGTCATAGTTGTTGTTGGATAGGACAGAGAGAAATGGA
GAGAGGAGGGGAAGACAGAGAGGAGGAGAGAAAGACAGACACCTCCAGACCTGCTTCACC
GCTTGTGAAGCGACCCCTGCAGGTGAGGATCTGGGGGCTCAAACCGGGATCCTTAAGCCG
GTCCTTGTGCTTTGTGCCATGTGCGCTTAACCCGCTGCACTACCGCCCGACTCCCTCGCT
GAAAATTATTGTAAGAAAAACTCAAAATTTTGATGCAGTGCCCTTTCTATTTCTCTCTAT
ATACTGATGGATAGCACCCCCCCCCCAAATGTCCAGAATGGGTCTTCCCAAGACAGGTCA
CTTTGGTATGTAGACTCTTTTGCCCTGAGGCCAACCAAGACCCTGCCGGCTCGTGAGGAA
CTTTCACCACTCCCTTAACTACCTAGGAGAATGAACGTTGGCTGTATTGCCTAGGTCTGT
TTGTTCACTCTTACCAAAGATAACCTTTCTGTTGGAGAAACCTTTATATGGCAGGGCAAA
TATCTTATTACAGAACACCTGGTCTTTATGAGTTCTCCTCCTTGTCTGATGAGTCTCCTC
CTTTCTTCTCAAACTCCATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved