Erinaceus_europaeus Locus Mono:202:SNORD58
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:202:SNORD58
Erinaceus_europaeus
Mono:202:SNORD58
scaffold_239084
SNORD58
1001..1062
2062
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGGCCGGTCCTTCCGCTTTGCGCCACTTGCGCTTAACCCGCTGCGCTA
CTGCCCAGCTCCCAAAAGTGACACTCTTAAAGGTCACATGACTGCAGTGATGCTTCTCTT
AGGATACCTTTGGATATATCATGAAAACAAACCAGTTCGTGGTCTGGGAGGTGGCGCAGC
GGATAAAGTATTGGACTCTCAAGCATGAGGTTCTGAGTTCAATCCCCAGCAGCAGCACAT
GTACCAGAGTGATGTCCGGTTCTTTCTCTCTCTCCTGTCTTTCTCATAAATAAATAAATA
AATAAATCTTAAAAAAATAATTCTGAGCCGCCACCTTTCAAACATTTTCTGGTTACCAAT
GTATAGTGTTTTGGGGAACTGTGTAGACCAAAGAACGAGTTGAACATAGTGTAGTGTGCA
AGTCAGGCTTTGGAACCAGTGACAAGCTGCTGGTATTAAAATACTTGAGTAGAGAAGGCT
GAAGTTCATTACATCCCTCAGTTCAAGCCAGCTAACTGTAAATTAGAGTTTTCTCCCATC
TCTCAAGAGTCCAGTGTTTTTAACTGTTGATATGTTCAAATTTTTAAATCTTGAGAAATG
GGTGTTTTAAAAGTGATCCACTGAGCAGGAGAGATAGCATAATGGTTATGCAAAAAAAAA
AGATTCTCCATGCCTGAGGCTCAAGTTCCAGGTTCAATTCCCTCTCACACCACCATATGC
CAGAGCTGAGCCATATTCTGATAAAGGAAGGAAGGAAGAAAGAATGAAAGAAAGAAAGAA
AGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAGAAAATCATCCATTAACATGTTT
GTTTGTTTTTTTAAGTCACAACATGAGTTACTTTCACCAATAAGTCCATTCTTTTCATTC
TATAGGCTTCAGCTTCCATGATGCTTGCTTGGGTTCTTGGAGAAGATGAGAAGACAAGAG
TGAACTAGGAGCAAGTCAGCATATCAAGAGGCCAGGAACCAAGAGCAGCTAGAGGGACTA
TTTCCAACAGACCCTTCCTTAAATTTCTTCAGTTCTGAGAGTCGGGCCGTAGCGCAGCGA
GTTAAACGCAGAAGGCGCAAAGCGTAAGGACTGGCATAAGAATCTTGGTTCGAGCCCCTG
CAGGGGAATCACTTCACAGGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved