Erinaceus_europaeus Locus Mono:467:SNORA27
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:467:SNORA27
Erinaceus_europaeus
Mono:467:SNORA27
GeneScaffold_1842
SNORA27
1001..1120
2120
TACCCCTGGAGGCAAAAGGATGGGAAAGGGGAATCCCAGGACTTGGGTTATATAAATGA
CTCCCTGTTGGCAGCGGGGTGGAATGGAAGCTATCTTTTTTTTTTTAATTTCTTTATTGG
GGGATTAATGTTTTACAGTCGACATTAAATACAATAATTTGTACATGCACAACATTTCTC
AGTTTTCCACATAACAGTACAACCCCCACTAGGTACGGAATGGGAAGTATCTTTACACAC
CCCTGGATATGGTCAGGCAGATGACAGGAGGGCCCGAGGGACAGCCCTGGACAACCATGA
GGTGTCTAGTTGCACCGCAGGGCGGATCACTGGAGGTCCTGGACACCCCTGGACAAAAGC
AAGTAACAGAAGGACCTGGGGGCACCCCTGGAGGTGGAGGGACCAGATGCGGAACTACAT
TAAGGTATTTTTCAGGGGGCGGGTAGTGATACTCCCGGTTGAGTGCACGTTATCATATAC
CCGTATCTGAACCCCTGATCCCCACCCTACCTGAGACGAAGACGCCTCATGAGCAGTAAA
GCAAATCTGCAGCTGACTCTCCTTCTCTATCCCCAACCCCCTCTCAATTTCTCTCCGTCC
TATCTAATAAGAAAGGATAGGAAGAAACAGAAGAGAGAAGGAGGAGGAGGAGGAGGCAAC
CAGGAGCGGCCTCAGCAATAACCCTGGTGGTAATTGAAGGAGGAAGAGAAGGAGAAGAGA
AAGAACATTAACGTTCTTTTTAAATTTTTTATTTATAAAAAGGAAACACTGACAAAACCA
TAGGATAAGAGGGGTACAACCCTAAAGGTCTTTTTTAAAGTATGAAAAAGTCCAAATCTA
ATAGGCTAATTTTAAAAATATATAATATTTAATATTTAAATTTATAATATATAATTAATT
TATTTGATAGGACAGAGAGGAATTGAGAAGGAAGGGGGACAGAGAGGGAGAGAGAGAGAG
ACCTGCTTTACTGCTAGTGAAGCTTCCCCCTGCAGGGGAAACAGCCCCATCTCAATTTTC
AAATTGGACTTGGGCCTTTATTGGTCATTCAAACGGGGCAAAAGAAATACCCTTTTAAAA
CTCAGGCAAACTGTGTTTGTCTTGTACCAGAGGAAATAAACAAAAAAGAATGAGTGAATG
AAGAGGGGCTTTGGGAGGGAGTGACTGGGAGGACAATGCTGCTGATAGCCATTTTTCTTA
TTCATATTTGTCTATTTGTTTTAGATAGAAGACAAAATTTGGGTGGAAAGTGTAGTAGTT
GAAAGGGAGGGTGAGAGAAAGACATCTACAACTACTGTTTTGTTGCTCATGAAGCTTCCC
CCCTGCACGTAAGGAAAAAGGGCTTGAACCCTGGTCCTTGTGCACTATAATGTGAGCATC
CTGCCAGATGCACTGCCCCTGAACCCAATAACTGCGTTCATTTCAGACTTTTCTGCCTGC
CCTCCCATCCATACACCCCCACAGCCAGAGAAGAATGATGTGAGCAGCCCCCAGACTCTC
CCTTCTCTATAGCTCTCAACACAAGATGTCCCAGCTCGGTTGCAAAGATAGCACAGTGGT
TTATACAACAGATGTTCTCATGCCTGTGATTCAGTGGCCCCAGGTTCAATCCCTGGCACC
ACCATAAACTAGAGCTGAGCAGTTTTCTGGTCAAAACAAAATGAAACAAAATGACCCAGG
GGCAGAGCGTTGCCACACTTGATCGAGTGCATGTTACCAAGCACAAGGACCCAGGTTCAA
ACCCCCAGTCTCCACCTGCAGAGGGGAAGCTTCACTAGCACTGAGGTAGTGCTGTAGGTG
TTTCTCCCTCTAGAGCCCCCTTTCTTCTCAATTTCTCTGTCTCTATTCAATAAATAAATA
GAATGTTAAATATACATACATATATATATATATATATATTTAATCTTTAAATGTCCCAGA
TAACTGTAGGCCTCTCCATTGCTATCACTCACCTTTCCCCCAGAAGCCAACTTGGCCATT
GATTCTGGAAAGATAAAAGTCAGGGAGCTGGGTGGTGAGACCTACCTGGTAGATCGCACA
CATTGCAGTATGTAAGGGCCCAGGTTTAAGACCCTGGTCCCCACCTGTGGGGGGGAGGGG
GGGGCTTCACAGTGATAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved