Erinaceus_europaeus Locus Mono:463:SNORA42
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:463:SNORA42
Erinaceus_europaeus
Mono:463:SNORA42
GeneScaffold_4194
SNORA42
1001..1138
2138
AACCCCATATAAACAAATCCTTCTAGGGTCAAGTCTTAAAAAAAAAAAAAAAACTATAA
GGGCTGGGTGATGGTGTATTTGGTTGAGCACACATGTTACAATGCACAAGGACTTGGGTT
CAAACCTCCAGTCCCCACCTGAAGGGGAAAAGCTTTGCGAGTGGTGAAGCAGTGTTGCAT
GTGTCTCTCTTCCCCTCTATTACCCCTTTCCCTCTCAATTTCTGTCTATATCCAATAAGT
AAAGATAATTTAAAAAGAACTTATGGGGGATGCCGGGAGAGCCTGAGGGTGCTTCTTCCC
GAGCAAGTGCGCTCTGGGTTGGAGAGAACTCAACTGGAGCCAACCTAGGCTGCTGCATGG
GAGAGGGATCAGGAACTCGTGCAGAGCTAGCGTCACAGGAGATAGACTCTAGAACTCTCA
GAGCCGGAAGGCAATCCCCAGTGTGTTAAAACAGAAGAGCAGCTATATACACACTCACCA
AGTAGGGTGGAAACAGGATGTGACGTAGAGAGGGTGGAACGAAAAGAGACTGGTGGAAAT
CAGGGTTACTATGAGAGGAGGCGAAGCAAAAAGACATCCTGAACCAGTGGGGATTAAACC
AATGCCCTGCAGGCAGGACAGTTCCTAGGTAACTGGTTATATAAATAGACCGCAGGGATA
AACAGGAGGAAGCTGGCATACTGCCCAACAGGGGAAGCTTCATGAGTGGTGAAGTAGTGC
TCCCAGATAGGGAACCTGCCTTGCCATAGATGTGGCCCAGGTCCCAGCACCACATGGGGG
TACAGCACTAAGGGGGAGCTCCAGTGCTATGATGTCTCTCCTTCTCTATCTCTCTTTCTG
TCTCTCTAGCTGAATTTAAAAAATATTTTCTTCTCTCCATATGAATACAAAGTCAGCCAG
AAGCAGTGGGTGTATGTATTTTTCATTGTAAAATAGGGCTGGGTAAGTCTTAGTAATTAT
TCAGATAGTATAATGGAAAAAACAAACATTAAAAACTTAGAGCATGGTAATGGATTTATG
GCGGGTCCTTCTGTGTGGGCCTCTCATAGTGTGCCCATGCCAGAGTGAACTGCAGCCTCG
AACTGTTGCCCAGCCCCCTTACAGTGAACTGTGAGCTCATTGAGTGAGGTCGTACGGTTG
AAATGGAAAATCTTATATATGTACATAAAAAATAGAAAAAGTCCAGTAAGTAAAAACATT
GTTCTGTTTTAAAAAATCACAGTATGCTGTGTTTTTTTTTAACACTTCTGAGTATTTTTT
TAAAATTATTTTTAGAACTTCTGATAAAAACACAGAACCCCTGTGGAGGGCTAATACTAT
AAGGCTTTATCAGTTAGCAGTTTACCGAGTCTAGTTAATACGTACACAGGATAATGCACA
GGAGAGGATACTGACAGGTGAAAATACAGAAAGGACAGCTAGGATAGGTAGAATAAGATC
AGCCTCACTTCACACTTTTAAAAAGGTGCCACTGCAGGGGCCAGGAGGTGACGTACCTGA
TTAAGCACATACATTATACTGCACAAGGACCCAGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGGGGGAGCTTCATAAGCCGTGAAGCAGGTCATCAAGTGTCTCT
CTCCCGCTCATTTTTTTATTATCCTTATTTATTTATTAGATAGAGACAGCCAGAAATGAG
AGAGAAGAGGGAATAAGAGAGAGAAAAAAACAATAAAGAGACACCTGCAGCACTGCTTCA
CCATTCGCAAAGCTTTCCCCCTGCAGGTGGGGACTGGGAGCTTGAGCCTGAGACCTTGTG
TATTGTAACATATGCATTCAAACAGTACCACCATCACCAGGCCCATCTCTCTCTCTCTCC
CTCTGTGTTTCTATTTCAATTTCTCTAAATCCTACCCAATAAGATAGAAAGAAATGACCA
TCAGGAGTAGTGCATGGTGGCAATTAAAAATAAAAAATCCAATACACATTGTCATTTACA
AAAAATATAATATATTGCATTACTGATAAATTAAAATATTTTTCTTAAATTGTGATTGTG
GTAATTTTTTGGTTTGTTACAAAGTCAAAATATAATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved