Erinaceus_europaeus Locus Mono:432:SNORA44
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:432:SNORA44
Erinaceus_europaeus
Mono:432:SNORA44
GeneScaffold_8646
SNORA44
1001..1128
2128
ACACCACATTCAACTTGGGCTTTCCTGCTCCCTAAGACACAGATTATTTAAGTGTACAG
CAAACATGTCCCATGTGAAAAGAAAAAGCATTTATTTTTAAAACATAGTTATCATTGTTA
AGTGACAGTGTAGTTGTTGGTCCCCATTTTGGTAGATGTTATTACCTCCCAGTCCAACAG
CACTGGGGCCTATCTGAGGGAAAATAAGTGCCCAAGAACCCCCTCATCCACTTCCTTTCC
CTCCCCATGTGAGAGTGCATCTGTGGCCTCTCAGAAAGAGGCTCAGCTTTTGCAGAGACA
CCTTCTCAGGTGACTGCAAACAAGTTCTAAACAAATTTTTTAATTAAAGAAAAAAAATTA
AATATCCTGATAGAGGGAAGGGGGCATATTTATTCACAATCAACCTAGAACTTGTAGAAT
TCTGCGAAAGTGAATGCATACTGGGTTAGTCGTTGATTTACACATTTGGGAAGAATAAAC
TTGAATTATGTGAGAGAAAAAAAAATACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTTTTACAAAGGAATCAATTTGAAAAAGTTCCCAGGTCATTCTATTAATT
TCAGCACTTCTTTCGTTCATGTAGAAAAGTTTAAATTGGAAAGAATGAGAAGGTGGCCCT
GGAATTTAAGGAAAAATAATTTAAATGAGCTAAAAGGCTGACTTTAAATATCATTATAAT
GTTAGAAGAAGGTGATAGCACAATGGTTATGCAAATAGACTCTCATATCAGAGACTCCCA
AGTCCCAGGTTTCAGTCCCCCAACACTATCATAAGCAGTGCTCTGAAGAAAGAAACAAAC
AAAGAAAGAAAGAAAAGGGGAAAGAAAGAAAAAAAGAAAGCCATCATGTTTCCAAGGTTT
ATGGCTAGTAATAACCATGGGATCTAAAACTGCATGGGGGAATAACCTGAGACTTTGAAA
GCAGAGGTTAGCATAATACCTATAGCTGTCACTCACTTTTCCTATATTTCAGGGGAAAAA
ATGTCTACGAAAGTGGTCAGAAGCAGAAAATTAAGAACCTGTCACTTCTAAATGCATCTC
ATTTCAGGAGCAAAGAGCACACAGCCTCTGAACAGGGACAGGACACTTAGCAGAGAACCT
GTGGCTTCTTTCTTCTCTTTCATGAGACTATCTGGAGTAATCACAGTTGCATCTTTAAAA
TAGTCTTTAGAGACACCAGTGCAGTCTATTCACCTGATATGTCAGCTGCAAAGAATAATG
AAATCAATAAAAATTTTTAATCCATTGTTGTCTAAGGAGAGTTTTTAGAACAGTAAACTC
CTCCCTGGAGACCAAATGCGAGTTTTTAATTTCTGTCTTCCAGGCCCTAAATTCTGCTTC
AGTGATGGTGAATTTGGGCTGCCCTGACCTGCCTCTCCATGTAGATCTGTCTCTGGAATC
TCCTTTTGGGTCAAAGCCTGAACTCAAATCTAGATTCACTGTCTGAAAGTCTCCCCACTT
ACCACAGTTTTCACCTTTAAATTGCCTGGAGGCTAAACTAAAATGATGCTGATATTCACA
GCCAGAGATATTCACAGCTAGAACTAGAAACAGTGCAGGAGGGCTCAGGCTTTGCTGTGA
ACAAGCTTTTTTTCGTGAATTTATGGGAAGCCTGTGGTGAATAACATTCTGTAAACTTGA
CTTTAATATGCAAGCTTTTTTTTTCCCAAGCTTTAATATGCACAGAAATCATGTGTCTTT
TCAGGGACCTACTCTAAAAAAAAAAAAAAAAAAAATCATGATTCAGCGGTTTTGTAGTGG
GAACCAGGCACTTACATCCTAAGTCCCCTGTGAGTGCTGATGCTGCTTCTCTAGGCCCAT
GATCAAAAGCCCTGTGCTGGGAACCTCCTGTTAACAAAAAGAAACAGGGTGGGGCTGGGA
GATACTCATCTGTGAGAGTTCACATTTTGTGTAGAGCAGGACTAGGCCACGCCATGGGAG
CACCATGTAAAAAGGAAGCTACATAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved