Erinaceus_europaeus Locus Mono:483:SNORD31
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:483:SNORD31
Erinaceus_europaeus
Mono:483:SNORD31
GeneScaffold_7382
SNORD31
1001..1068
2068
GGCATCAAGCCCCAGCAATAACCCTGGAGGCAAAAAAAAAAAAAAAAAAAGAAGAAAGA
GAGAGGGGCGGGAGAGACAGAGAGGCACCTGCAGCACTGCTTCACCACTTGTGAAACTTG
CCCCTGCAGGAGAGGGCTGGGAACCTGAACCCAGGTTCCCGCACACTATCATGTGAGCGC
TTAACCAGATGTGCCACTGGGTGGCGACCTGAACGCCGCGTCTCTTACATGTGCAATGCC
ACACTGAGCAGACTCTCCGACCCAATTTTTACAATTTTTGTCAAATTCAGAGAGGGAGAG
AGATGAAGAGACAGATAGAAGAGAGACATCACAACTTTGTCCCAGCACCTGTGAATTCCC
CAGGTGCTCTACCTGGGGCTTCCATGAGGTTTTCGAGCTGAAACTCAGGGCCTCAGGCAT
GGCCAGCCTACACTCACTATCAACAACACAAACAACCAGACACACAACTCCACTGGAAAA
TATATAGAATTTTCACCATAGAAGAAGACTAGAGGACCAAGAGTCAGGTGAACTTAAAAA
TCATTGCCTTATTAGAGAAATGCAAACAAAGACCCTCAGCGAAATACGGCTTAATACCCC
GCGAGAATCTCATGTACCAGCCAGGACAGAAACAACTGGCATAGGACACCTGGAAAGAAT
GTGGAATAAAAGGAACCCCTGGGCTCAACCCCTGCTCTGGAGATTTCTCGGAGCACTAGA
GGCGGGCCTACCTATATGCTCAGTGACAGATGAGTGACCTAGAAAGTTTTGGTGTGGGCT
GGGGAGACAGCATAATGGTTCTGCAAAAGACTTCTGTGCCTGAGGCTCTGAGGTCCCAGG
TTCGGTCTTCAGCTCCACCATCAACAAGAGCTGAGATGTATTCTGCTCCCTCACCCTTCT
GTATCTCTCTTTCACTAGAATAATAAGTATTTTCTTAAGAAGAAACTTTTGAGGGTATTT
CTGTGTCCTCAACAGTTTGGAGGAGCTTTAAAAGTATGGGTATTACTAGTGATGAATTCA
TTGCCACCCAGTCTGATCGCTGTGACTGATAGGTATTTCCTGAGCTGTGAGCTTTCTTGG
GAATGAAGAAGTGACTATGGGACGTAGGATCAGTTGGCTCCAGATTAGCCCTATAAACAT
GGTTTGAAGCCTGCACATCTTTAAGCCAGGAATCCATGCTGGAGGGTGACTTGATTCCCA
ACCATTCTATTCTAGGGAGGCTGCCTGCCATTGTCCTGTTGGAGAATTCAGCCTGAAAAT
CAGGAATCCGGCCTCAGAAGACACAGCTTTTTACAACCTGTCTGCATTGGTTAACTCTCA
ATTCTAAATAAAAATCTGTATTTTAACATTAGAAAAAAAGTATGGGTTTTGTCTCCTCCT
AAAAGGTTTTGTAGAATACATTTGTAAAGTCTTCTGGGCCAGGACTTTTATTGTTGGGAA
GGTTCTTGATAACTGTTGAAATTTCTTTGGCTGTGACTGGTCTATTTGTGCTCTCTAGTT
TCTCCTGCTTCAGTTTTGCTTCTAGGAACTTTTCTGTCTCCTCCAAGTTCCCCCTCTCTC
TCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTACCCAACAATAAACAACATCACCACAA
CAAAGCCACTACAACAAGGGCAACAAAAGGGAAAAAATAGCCTCCAGGAGCAGAGGATTC
TTAGTGCAGGTACTGAGCCCCAACAATAACCCTGGAGGGGAAAAAAAGGAACTTGCAAGA
GCTTAAGCTCCAGGAGGGGAGGTTGATGTTTGTGTCAGTTTTGAGGATGGACTGGATGTA
GATGGGGTTGGGATAAGGAAGTCAGCCTTTGGAACTCTCCAGAAAGAGCAAACCAGGAAA
TGAAGTCAGAGGCATGGAGTAGAACAGAGTACACAAGGCAGAATTTGGACTCTGCACAAT
CTTTGTTGAGTTGATGAGCATGTGGGGAAGCTAGCAGGAAGCCAGAGGGAACCAATGCAG
AGAGCTCTGCTAAGATATCTGGTCCCTGAGGGTGGGTGGGAGTCTGACTTCTGCGTCTCA
GCTGTGACGTGGTAACAGTCAGCACCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved