Erinaceus_europaeus Locus Mono:61:SNORD35
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:61:SNORD35
Erinaceus_europaeus
Mono:61:SNORD35
scaffold_353244
SNORD35
1001..1087
2087
TAAATATGCAGGAAGAATCCCTGCACAACCATGAGCCAGAGTTGAGCAGTGCTCTGGTA
GTATTTTTTAAAAAGTATGCAGGAGAACCTGGATGTTTAAGAGGAGATGGGGGAGTCGGG
TTGTAACGCAGCTACAGGTGGCACAAAGCACAAGGACTGGTGTAAGGATCCCCGCTCAAG
CCCCGGGCTTCCCACCTGCAGGGGAGTGGCTTCACAGGTGGTGAAGCAGGTCTACAGGTG
TCTATCTTTCTCTCCCCCTCTGTCTTCCCCTCCTCTCTCCATTTCTCTCTGTCCTGTCCA
ACAACAACATCAATAAGAACAACAACAATAACTACAACAGGGCAACAAAAGGGAATAAAT
AAATATTTTTTAAAAAGAGGAGATGGAAGCTTCATAAGCGATGCTTGACCTTGTCTCTCC
TCTCCCTTCCTTCCTTTTTCTTTTCTTCTTCTTTTTTAAACCAGAGGACTGATCAACCCA
TGCTTGTGGTGGTGTTGGAATTGAACCTGGGACTTTGGAGCCACAGTCATAAGAATCCCT
ATGATGCTATTATTTTTAATGACAAAGATATAGAGAAGGAAGAGAGAGAGAGAGAGAGAG
AGGCACTAGAATACTGTTCAGCTCTGGTTTATGGTGGTGCAGAGATACAACCTAGGACTT
TATAGCCTCAGGTGTGGGTCTCTTTGCATATATTATCTCCTCCCCTTCCCTACATCTTTC
ACCAGTTGCAATAGAATCATTAGGTGGGTACTGAGCCCCTGCAATAACCCTGGTGGCAAA
ATACCACTAAGAAAAATAACCACCAGAGAAGCAATGTCCTGGAATATGCATCGTGGGCAG
CACTTGGAAGTACTCACCACAGCATTCTCAAGTCAGGGTGTTACTTTGGTGGTTGAACAC
CATGGGCTCCATTAAAGGTAGAGTCAATGCAGATTTGGCCTTGTTCCTCAGACTTAGGAA
CATTGAGTCACAGGTAAAAGATCTGTGAGAAAGAACCAGAGCGCAGATGATGGTTTGTTC
TCACGATGGTCTGCAATTGCCACTAAAGGCGCTGCCGAAAATGCCCATGGCTCAGCTGAT
GCCAGGAGGAAAAAAAAAAAAAAAAGAACCAGAGCATCACTCTGGCACACACAAGCCAGG
GACAAAACTCAGAGCCTCATGCTTGCAAGTCTGGTGCTCTATCTGCTCTGCCACATGCCC
TAACCGCAGAGGGCAGAGCATTTTTAAGATCTAACAACCCAAGAGAGCCACCTCTTTCCA
ATGCACCACACCATTTCTTGTTAGGCTGATAGGCATAAACTCGAATCAGCTGACTTTTGC
CTAAAGCAATACTATGATCCATTTCCACTCATTTTGCTAAAGCCTCAAGCCCGCATGCCC
CCGCCGCCCCCAGCACACAGGTAAGGAAGTTGCATTCACAAGCGTCACCTTGGCCTGGCT
TCGGTGCACAAGAGTTGAGCTCACAGAAAGCAGCGGGTCTCCGCCTGCTGGGCCGCACAG
GAGGGGCGCGGGATCCGCAGGGTTTGTGCCGACGCCGAGAGTCCCTGAGCCTCCTCCGAG
AACCTGTCCCGAGCGGGACTTGCCCCAGCCGACGCCACGCAGTGTGTTGCAGCCCCGCGT
GCAGCCTTCCCGCCAGTTCTGGCCCCGCCCCGCATTCCCGCCCGCTTTCGCCCCAATCCC
GCGCGCTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGCATCCCCTCTTCGTCCTTCACTCAGATGGTGGCTAC
TCACCGCGCGGGCGTCGCCCGGGCCCCACAGAGCCCGGCGCGTGCATGGTGCCGGCGGTC
TGGAGCAACAAAGCGGTCACAAGCCGGAGCTCGGCGCCGGACAGCGGTTGCACGTGAGCG
GCGGGAGGCGGCAGCGGCACACGGAGCTGCAGTGGCCGGCGCGCGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved