Erinaceus_europaeus Locus Poly:14:SNORD99
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:14:SNORD99
Erinaceus_europaeus
Poly:14:SNORD99
GeneScaffold_7574
SNORA61, SNORD99
1001..1134, 1918..1997
2019
GTTAGATCATGATGACAGCCTAGCCCTCTGGTTCCCTTGTCCCATCAGATCTGAATCTA
GGTCTTGGTGGTCGTAAAAGGAGGGAGAGCGATATTGAAGCTGGCTTCATAGGCTCTGTA
GTGTGCCATTTAATATGTGGGCTAGTTTCAAACAATTTTGAACTTGAATTTTTTTTTACC
AGAGCACTGCTCAACTCTGGTTTATGTTTTGGGGATTGCATCTGGGATGTTGGAGCCTCA
GGCATGAGTCTCTTTGCATAACCATTATGCTATCTAACCCCACCCTAAGCTAAGCATTTA
TTTACTGCCTTTTGTTGCCCTTGTTTTATTGTTATTGATGTTACCAGGTGGGGAGTCAGG
GGCTCAAACCAGGATCCTTACACCAATCCTTGAGATTCATGCCATGTGGGCTTAACCTGG
ACACCCACCCACCCCTGAGCAAGTTGTATTTGTTTTAAAGATTGCAAGTTTGTTCGTGCT
AAATAACTTTAACTTTTTTCTTAAAGATCTGTTACCAGTAAAGCAATCTTCATCTGCTCC
TAGGATGTACTCTGCAATACAGAAAAGGTAAGTTCAGAGTGGAAAGTTAAATTGGTATTT
GCCAGTTACTTGTAGATGAAAACATTTTTACTGGAGCAGTACTCAAATAAAAGTGGTGAT
GTGTGCATGCTAGCTGAGCTCTCCTAGACTTGACCTTCCTAATGGCCAGAGCCATATTGA
TGGGTGGCACCCTTGGTAAGGACATGTTACTATACACAAGAACCCACTTTCAAGTTCCTG
GTCTCCTTAAAAAGGAAAAACTTTGAGCAGTGAATTAGTGTGTCCAGTAAGGAAAATATA
AAAAGTTGATTTTTGCTTTTAGGTAACCTCAAACCACCTTCCATTGCCCAAGAAGAAGCA
GGGTAGAAACAATCTGATCTCAGTATAGGGTGGCTGTCTAACTGGTCAAGGATGAAAACC
TATCTCTGTGGACATCATTGGATGATAGATGCGGATATGGGACTGAGACCAGTTCTAGGG
AAATACAAGTGACATCAACTGATCTGGACATTACTAATACTGGTGTATATACTTTTTAGG
AGAACCAAAAGGAACCAAGCTGAGAAGGGAAAGTGGCCGGGACTACAATGGTCGTAGTCT
TAAGGCTTGAAGACTGATCCCAAGCATCCCATCTTTGTTGATAAAAATAAAATATATTTG
TAAAAAGTCGAAGTGTATTTGTCAGTTATTTCTGTGTATGATTCTCACAGGCAAATTCAC
ATCTTTTGCCAGGATTTGCTTTCATGGTTTTTTAAAAAATTATTGACTAGAAACAGAAAT
AGGGGAAGAGTCAAGACATCTGTAATCCTGCTTCATCACTACAAGTGGGTGCCAGGGGCT
TGAATGCTTTAGTTTGTGTTTTATTTTCATATAAGAGCACTGTTCAACTCAGACTTAATA
GTGGTGCTAGGCATTGAACTTGAGGCTCTGTAGCCTAAGGCTTGAGAGTCTCTTTGCATA
ACCATTGTACTATCTACCCCCACCCATAATTTATTCTTACTAGAAAGGTATACTACTCAG
TTATATCAATAACCCTGGATTTATGGATCCTGGTTTGAGTCCCTGACTCACTGCAGGTGT
CTTTTCTTAACCTCCTCTCCATTTCTCTGTCCTATCCCACAATGACATAACAATAAAACA
AGGGAATAAAGATTAAAAAAAACAAGGATTTGTATAAGGATCCTGGTTTGAGCCCTTGGC
TCCCCACCTGCAGTGGAGTCCCTTGACAAGCAGGTCTGCAAGTGTCTTTTTGTTTTTGGG
CTCCAGAGTCATCAGTGGAGTTCAGTGCCTGCACCAGGAATGCACTGCTCCTGAGGCTAT
TTTATTCTTCCCTTTTGCTGTCCTTGTGGTTATTGTCATTGATATTATTGGGCCGGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved