Erinaceus_europaeus Locus Mono:34:SNORD22
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:34:SNORD22
Erinaceus_europaeus
Mono:34:SNORD22
scaffold_355332
SNORD22
1001..1127
2127
CTCTCTCATCCTCTCTATCTATCCCTCTCTCCCTCTCTGTTACCCCCTTCCCTCTAATT
TCTGTCTCTATCCAATAAATAAGGATAATTTTTTTAAAAGGGCTCTTGTTTTATATAAAA
GGACAGTACACTATTTAAAGTATATTGAACTTGGTTTCTATCACTTGAAACTAAGAGAAT
TATATATGAAACAAAAACCAGTACTTGGAAATATATTAATATAAATATATGTATAACAAG
AAAATGACTGTTCTGTGTAATAATAACAGCAATTCTTCCTTACTTAATAAGCTAAGAAGT
TGAAAGTGTTTATACCTGAGGATACAGAGTATACCTAACAAGATTGGAATATTTGGTAGC
AACTTTATAGAAAAACTAGAACTAATGTAGGAACCTATCTGGTTACTTCTTCACTGTAGT
CTTTACTAAGCTTCAGTCAGAAGCAAACACCGTTTTTTTATTTTTTTTTTCCTCCAGGGT
TATCACTGGGACTCGGTGCCTGCACCATGAATCCACTTCTTCTGGAGGTTTTTTTTTTCC
CCTTTAGTTGCCCTTTTTTTTTTAATCATTGTTGTGGTTATTATTATTATTGTTGATGAT
GATGCTATTGTTGTTGGATAGGACAGAGAGAAATAGAGAGAGGAGGGGAAGATGGGGGAG
AGAAAGATAGACACCTGCAGACTTACTTTACCGCTTGTGAAACAATACCCCTGCAGTTGG
AGAGCCACGGGCTCGAACCAAGATCCTTACCGCTGATCTTTGCACTTTGCACCATGTGCA
CTTAACCCACTGTGCTATCACCCAAACCCCACCCAACACCTTTTGTAGACAACTTCTATT
CATGCTAACCTATTTGGGAAAAAGGCAGTGAAGAAAATAAAATTTTGCTGAGGAAACTTT
TCTACTTATAAGTAACTGAATGTGTTTTAGATTCTGTTTATCTTTTTTTTTTTTTTTTAC
TTGCAAGACTAGATTCTCTTGCAGTTAAATTCTCTCCGCCATCCTGGTGAAAAAAACACC
CAAATGTCTTACCTCCTGTCCTAGTCCCAGAGCCTACAAAGGTGAACCCACTGGGACTGG
CTGGGAGAAAAGAGAAAATTCTATTCCAGAAGGAACTGTCTGAGGGATTAGAAAAAAAAA
AAAATGTCTCCTCCAGCCTAAGGTTGGAATGGAAGCTAAACGTGGAGGAGATAAGATAGC
AGGAGAAATAAACAAGTGTCTCCCTCAGACACCATTTAAACACTCCAAACTCATTACGTC
AAAAGGAAAGAATCAAGGGCCAAGTAAGGAGATAGTCACTGGCCTAGCAACCAGGGACAA
GGAAAAGATCAGAAATAGCTTTTGAACTGTCAAGACAGGCCAAACTGAAGAGTATTAACT
CTTCACATGTAACACCTATTCTAGAGGCCCACTGATCAGAATCTAAATTCTGAGGCACTG
ATTTAACTAGCTAATCTTTGCCTTTATTAAACTGCCTCTTGCCAAGCCCTAGGCACTTGA
TATCACATCCAGTTAAACTCACATAGTACTAAACTCAAGGACCCATGAAAGGATCCAGGT
TCCAGCCCCACTTCCCACCTGCAGGGGGCATACTTCAACAAGCTGCAAAGAAGGTCTGCA
GGTATCTATCTTTCTGTCTCCCTCTCTACCTCCCCACACTCACTCAATTTCTTTCTGTCC
TATCCAATAAAATGGGGGTTGGTGGTGGAAATGGCCACCAAGAGCAGAGGATTTGTAGTG
CTGGCACCAAGTGCCAGTGATAACCCTAAAGGCAAATAAAATAAAATAAGTCAATTATGT
TTTCAAAGAATTCTTTGTCAGTTGTTCTGTAACTTTCTTTTGTCAAAGGAAGTTCTTGTT
CTTTGAAATATTAAATGTCCTAAAAGCTTAGACCAGGGAGAACAGAAGCAACTGGTGGTG
TTACTTTATAAGATGCAGCTATATGTAAATAGCATAAAAGGACAAATTATGGTGAGATCT
TGTATGCCACAGCATATCCTAACAATGGGATTTGCAAAATTAACCCAGTTGCCAAATAAT
TTGGTTATATCAATAACTATCTATTGTCTTCTTAAACCCTTAGAGATCAGAAACCTTCTC
CTTTCTCTATAAAGCCCATTATTTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved