Erinaceus_europaeus Locus Mono:304:SNORD77
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:304:SNORD77
Erinaceus_europaeus
Mono:304:SNORD77
scaffold_298566
SNORD77
1001..1064
2064
AAAATTAAAAATTTAAAAAAGGAGTCCAGACAGTGGGTTAAGCACACAGATTACCAAGT
GCAAGGAACTGGGTTCAAGCCCTGCTCCCCACCAGCAGGGGGTTCATTTCATGAGTGGTG
AAGCACGTATGCAGGTGTCTATCTCGCCTCTCTCATCTTTCCATCCTCTCTCAATTTCTC
TCTGCCCTAGCTAATAAAAAAATTAGAAAGAAAAAGAAAAAATGCTCATCAGGAGTGGTG
GATTCATAGCGTTGGCACTGAGTCCCAGCAATAACCATGTTGGCAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGGAAAGACTTAAAAACTAAATTGTA
ATGAATTTTGTAAATTAAAATATAATGAACTCAAAGGAAAAAAAATTAACAAATTTGACA
GCTCTTAAGTTTAAAGAGATGTTGTATTTTTTGTTTCTCTTCTTTTTTTCAATAAAAATG
CCCTGTTCTAGAGCTTTTTAGGTGATGTGGTAGACACTTAACCTACCTTTTGTGGAAGTT
CTTTCAGCTTCTAAGATTGAATTAAATTCCAACAGTTGTTGTCATATAATTATTTCCCAA
ATAAAACAATTTTTATAAAGAAAAGGAGGGGAGGGAGGAGGGTACAGCCAGCAAGAGCAG
CACTCCACAAATGAGTGCCAAGGTGGTTTCTGGAACTTTCTTCTTATATCGTCCTCTTTC
CTCTTCATTTCTGTCAGACTTTATGGAATACTTTTTTAAAAAAATTCTTTTTCTCTGTAA
ATTTTAATTCTGAATCTGTGGAATCTGTAGGCTAATGAGAGAATGAGCTACGGCTGTCCT
GGGGGTGATAGGACCATGGAATGCATGAAAGAGATGAAAATCTCCATCTTAAAGAATCAG
GAAGATGGATTGTCTACACTGAGACCCAGAAGTAGACATTAATTTTGTGGCACCTAAGAT
TTATACAGTTGGGGGAGGGAGACATTAAGAAAAAGCATTACATACTATGATAGTTGCATA
GTTCATCAGAAAGTCCTGAAGAGATGCACTTTGTCTGATGTATCTGGGGGGAAAAAGAAA
AGAAAGAAAGAAAAGCACTATTTGATTTCAAAATTAGATACAAGAACTTAGCACGGAACT
TTAAACTTAAGCTTCATTAGGTTTAGGACAAATGTCCCATTTTTGTTAAGACCTGAAAAC
AAGTGGAATTTAACCAAGCCAGACAGCAGAAGAAAATTTTGACCAAAAGAACTGAAGTCT
AGGATGAGATGGGGATTTGGGAGCCCAGACAAAAAGTGGGGAAGTGGCAAAGGGTGAGCT
GGTAAGGTTAGAGATTTGGACTTCTTGCCAGGGCAATAAAAAGTCATAAAGGGTTTAGGG
AAACGCTGCCAACAGGTCTAATTTGAATTTTGAACAGCTCACTGTGAGGAGAGAGAATTG
AAACTCTTATATTTCCCCCTGACCCTCATTTTCTCTCTTCCCATTTTGTTTTTTAGTTTG
TTGACACAACTGCTTTATTTATAAATCATTTTCTCTTAAAGTTGTCAACACATTTCAAAA
GGGGCATCACTATATCAGGTGAGAAAACATTCAGCCCAGAGCACTCCTACTGTCTTGTCT
CTTTCCTCCTCTCTGCGAGAAACAGCTTGCCCCCAACACAAAACGTTTGAGGAAGTGGAA
TACAGAAGCAGTGACTTGCTATGAAGCCCACGCAAATACTACTAGAGATTTTAAAAAGTA
TTCATTACTTGTTGGAGAGGTAAAGCAGATTTTATTCAAGGGGAGTCATCATTTTAGCTG
TAGGAACCACTGCAGTGGGGTTGTGTCCTGAAAGAGAAAGAAGCAGCACAAATGGAAATT
TATAGTAGGGTTAAGAGTTGGGATTGACTAGGAAGAGACATCAAGGGGGAGGAGAGTTTA
TTAAACTGAAGGCAGAACAGGGTGATGAGATACATGGGGATGTGCTGAGGATCAGATATC
CAGCATGGAGAGTCCTGGTTAAACTGACTTAGCAGAATTTTTGCTGGATCCAGGGATGCA
AAGACAAAAGGGCAGGCCTAGTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved