Erinaceus_europaeus Locus Mono:352:SNORD29
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:352:SNORD29
Erinaceus_europaeus
Mono:352:SNORD29
scaffold_271081
SNORD29
1001..1065
2065
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCATTTTTTGAGCCTGCCAGAGTAAGGTTTTGGG
GCTCGTCTTCTTTGGGCCTTTAAATATTTGGGTCACAAGGGAAATCCCAAGCCACTGTGG
GAGTGTCAGAGGGACATAGAGTGGAAAACTGAGTCTGTAGCTTGTGAAAGTCAAGGAATC
CTTCCCAAAGGAGGTGAACTTGAAACTGAAAGTCAGAGGACAAACTAAGGCAGTGGGAAG
ATAGTGGAGGATGTTGTAAGTTTGAAGAGGAAGACAAAGGGAGGTTCTTCTGACTGAGTG
CAGAATCACAGGCAGGGGCAGGTTCCCACAGAAGGGGACACTGCCCTGACCTCTGAGCCA
CTCAGTTAATTTAGGATGATCCTGAGTGACCTTTTTGGGCTTTGAGAACTGGTAGCATGT
CTTGGAGCTATGAAGCTCATGGCTTTGACGTTGTCACTTTGTTTCTATGATGAATCAAAC
TAGCTCACTATGATTAATACAATGAAGTTGTCACTTTGGCAGATGACCGGGGGCCCTTTG
GTGCCAAGACACTTTTAGTCCTGAGCTGAGAAACTTCCTTTTTGAGGTCCCTAAGGTGAC
AGGCACCCACGTATAGTTGACATCCTATCAACACTGACCATTTATTGGGTCCCTGCTGTG
CTCTGGCTCTTTCCCCAGTCATCTCTGAGTTTCATGCCAATCCTGGGGAGGTCTTATCCC
TAAGTACTGCTCACTGGAGGGTCATCCTTTATGCTCCCCAGAACTTCTGGCCACTACTGA
GGAAGATGGGGCCAGGGATGTACCAGGTATCTCTCCTAGAAATGTGGAAGTCCTTGTTCT
TTGCTTCCCTCCTGGTCACCCTCTTTTTCTAGCTTTGTGTCAGGCTCAGGGGCTGAAACT
TGAGAGTGATTTGTCTTGGTGCTTCCTAATATCTGTGACCTTACCTCCCATTGCATTCTG
GGGAAAAGACTGGAGAGGCCAGGAACTGGGACATTGTGAGTTTTTAGATGCTTCGTAAAG
GTCACTCATTTACACCAGTTTTTTTTTTTTTTTTTTAAAATCTGAGCACTTTATATTCCC
TTTAAAAGATTATTTCTCAGGAGCTGTTTTCCTCAGACCACTGGGTTTTGGCTCCTGTTA
AACAATACCCCGGTGAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GAAATCTGTGTTGCGCAGACATATCTCAGAAAGATTCCAGTACATAGCTGGAAGGAACAT
TTGGCAAAGTGTTGTGTTGGGAACCAGGGCAGGCTGCCACAATAGACATGTGTAGAGTTG
CCTTCCAGGTAAGTAGAGTCTCATTACCTGTTGGACTTTATCTAGGGGGCTGAGCGAGTT
GGAGGCTGGTGCTGAGTTCTGCTGCAACAGGGGAGAAGCTCCAGTGATTTAGATGGGACT
TGTTTAGCCGAGCTTGTTATAAGCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved