Erinaceus_europaeus Locus Mono:14:SNORA36
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:14:SNORA36
Erinaceus_europaeus
Mono:14:SNORA36
scaffold_295697
SNORA36
1001..1128
2128
CATTCCTAATTTCCCCCCATCCCAGTTCTTTCTCTTTACAAGAAGGGGTATCCATATCA
TTATGATTCTGGATGTCAGATTCCTAAAGATGGGAGGGGCAGCCTGGAGGACACCTTCTG
TGGGACTTCTGGGTGAACCCTCTATTCTAGATGCCCTATCAGTTCTCTTCTCAATAATTG
TGAGTGATCAGGAGTCCAGCTGGGTCTTCCTGCTCTTTGCGTAGATACGGCCATTGCACA
GAAACTCTCAGATGGTGAGTAGCTGTTGTATGTTGGCACTTTGTGGCATGATTAGATCAT
TTCACATGCAAACTCTGATCCCACCCAAACTCCTCGGCAGGAGTCTGACCTGTTGGACTC
AGTGTGAGTGAGATTGGGTGGAGGTAGCAGTAGAAGTATACTTTTCTACTCTGGGGTTTA
ATTATGAAAGATACTATGCTGAGATCCAGTGTTAGTGGGTGGAGTCCTACTATGTGCTTT
CTGCTCCTTCCTCAGAACCAGTTTCTCTTCAGGGACTTTCCATTTCTATCTCTACGCTCA
CCTGTTCTTTGGTTCTGAATGTCTTGTGGGAGTGATCTCCCCTTTCATGTCTCATGACTG
CCTCTTTTCACTTGCTGGGTGGGTGATTCAGAACACATCCTCTTAGAAGATGGAACGTCA
GGTTCAGGCAGCCAAATCCACTCATCTATGTTTTATAATTCATTGACGGCACTCTGTTTT
TTAAGTTCTTTCATATGGTTGTGAATCAGTCTTGCCACACCCAGTTCTTGGGTACAGTGT
CTGTTTAATCTTGAGTTCTGCTTCCTCCCTAACCCCTATCACCCACAGATCTGTTGTTTC
ACTCAAGAGGGTTGCTGCTCCTAGTGGTTGTCTGTGTTACACTATTGCAGGTATTATGGG
GTATGGCCAGGGACAAAACAAACTGAGTCCCCCACTACACTCTTCAAATTGGAATGAGGT
AGGTAATAAGTCAATTAAATGGTCATTTAAAAGATGTCGGCTTTCTAAGTGTCAAGTTCA
GTTCAGGACAGCTTCCCTGTTCTGCTTATTAAACTTTGGGGCACATTGAAACACAAACGA
GGGGAGATAATTGGATAGAAAGTATTACGCTTTTTATCTCCCAATATATAGAAATGAAAC
ATTTGATTCTAGTCTGACTGAGATGGGAGACTCTGGAAAGGTATTGAGCAGAAAGGGAGT
GTGGGCCCAAGGTCACTGTGGGATGCAGAAGGTAGAAGATCTGGCTTCTGTAATTTCTTC
CCCACTGAACATGGGTGTTGACTGGTTGATGCATACTCCCAGCCTACCTCTCTCTTTCAC
TAGTAGGTTGGGGCTCTGGGGAAGTGGAGCTCCAGGACACATTGGTGGGGTTGTCTGTCC
AGGGAAGTCTGGTCGGTATCATACTAGCATCTGAAACCTCGTTGTTGAAAAGAGAGTTAA
CATACAAAGCCAAACAAATTGTTGACCAATCATGGACCTAAAGGCTGGAATAGTGCAAAT
GAAGAGTTGGGGGTCCTCCATTTTGTAGATAGCTATAGGCATATTTTAGTTAAATTTCAA
AGGGCCTATAGCTATACTAGTTTTTTTTTTCCCCTGAGCCTGAAATCTGATATGTAGGTG
GATCTAAGTTATTGTCTGGGGAGATAATGTCATGGCTGTAAAAAGGACCAGAAAGCTGCA
TCAGGGAAGAGAGTAGAGTAGCTCCCTAATATGGGAAAGGGGTATAAATATTGTTGACTG
TAAACCCCATCGATTTGATTTGGTTTGGGACCCATAATCAGCTTAGGAGCCTATGTGACC
TCTGCATTCCTGTAGATCTGAGCTCACATTCTGTGGTCATGAGTAGGAACATTCCAAGCT
TCCCCAATATTGACCCATCTTCCTCAGGTATAGCATAGAGTATGTTGTCCATCTTCCCTT
CAGAGGAGGGAACATTCTCTACCATTGTTGATCCAAGTTGAGGGCAAGGTCCTATGGGGG
CCCACAAAGAGGTCTATTGTGTTCCTGATAGAAATGACCAGTAACAATGGAGAGAGGGAT
TTATTCGAGTTCTAGGCCCATCATGGCTGTTTGGGAATCTTAGGACTCCAACTTGGGCCT
CAGATGATGGGGCGGCCTGATAGTGACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved