Erinaceus_europaeus Locus Mono:41:SNORD60
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:41:SNORD60
Erinaceus_europaeus
Mono:41:SNORD60
scaffold_250571
SNORD60
1001..1082
1280
TGGTAAAGTACACACATTGCAGTGCACAAGGACCCAGGTTTAATCCTCTGGTCCCCACC
TGTATGGGGAAGCTTCATAAGTGATGAAGCAAGTATGCAGGTATCCCTGTTTTTTTCCCT
GTCTATCTACCCTTTCTCAATGTCTCTCTATCCCTATCCAATAATAAATAATAACTTTAA
GCAGTAAAAGAGAGAGAGAAGCCTGTCACGAGTCTCTTTCATTTCTGACACTTTGTATGA
GAACTGCATGTGCAGTCTGATTTGCAAACTTCCCTAGTCTAGACAACATAAAAGACATAC
AGGTTCAAGAATCCCAGAGGGTCCCAAACAAAATTAACCCAGACTTAAAGATACCAAGAC
ACATCATATTTAGAATGGAAAGGAATAAGGATAAAGAAAGGATCCTGAAGGCTGACAGAT
GCATGAGAAAAACAAAGAGTAATCTACAGAGCAAACCCCATAAGATTAGCAGCAGACTTC
TCCACACAAACACTACAGGCCAGAAGAGAATGGCAAGATATCTATCGAGTGCTCAATGAG
AAAGGCTTTCAACCAAGACTATTGTATCCTGCTAGACTGTCATTCAGACTAGATGGAGGC
ATCAAAATCTTCTCAGACAAGTTGAAAGAATCAACTATCACCAAGCCTGCCCTGAAAGAA
GTTCTGAAAGTTCTCCTATAAACAGTCAGACCACCATAAATATGCCATGTAGCAGAACAC
TCTAAAAATCTACAGGAATGGCGTTAAAATACCATCAATTTTGATAATCAATAAATGTCA
GTGGCTTGAATTCACCTATTAAAAGGCACAGAGTAGGAAGATGGATCAGAAAACACAACC
CAACAATATATGTTGACTACAGGAAACCCACCTAACTCAACAAGACAAACACAGACTCAA
AGTGAAAGGATGGAAAACTATCATAAAAGCCAATATCACACAAAAAAGGGTAGGAACAAG
GTGGCCCTACTGAGCAACAGCAGCTGTGATTCTCTTCTCTTCTCTCCTGGATCTACTAGG
AATACAGCTATGCTCATATCTGACATGATAGACTTTAAAATAAATAAAATTAAATAAGAT
AGGGATGGACATTACTTAATGCTCAAAGGATCAGTCAGTCAAAAGGACTTAACAATTATT
AACATCTATGCACCTAATGAGAAGCCATCTAAATGCATCAAACATCTATTGAAAGAGCTA
CAGCAATATATTAACAGCAACACAGTCATAGTAGGGGACTTCAACACCCCACTCACTCAA
CTCGACAGATCTTCCAGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved