Erinaceus_europaeus Locus Mono:224:SNORA5
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:224:SNORA5
Erinaceus_europaeus
Mono:224:SNORA5
scaffold_372364
SNORA5
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGAGACTACAGA
TCCAAAAAGGATGGCAGAGGACCTATTAGGGTTTGAATTGTTATGTGGAAAACTTAGAAA
TGTTATGTACAAACTATTGTATTTACTGTCAAATGTAAAACATTAATTCCCCAATAAAGA
AATTTAAAAAAAAAAGAAAAGATGTTTAGAGATATTATGCATGTACAAAGTGTTTTATTT
ACTGTGGAGTATAAAACATTAATCCCCCAGTAAAAAATTAAAAAATACATGTGACAAGAA
CTACCACAGTAAGAAGTCACAATTATCAAAGTATCTTTTATAGCAGCTGTGTCAAATTCA
GTGCTTACCAACCAATGGCAGGCACTAGCCCAAAAGGCTGCCATAGTAATAAGGTAACTC
ATGGGCCCTGATTCTCTCTCCTGGGCCTTAGGGATAAATTTGGTTACAGACACTAAGCAA
AAGTATAGTAAAACTCAGCAAATTCTGTATTACATATACTGAGTAGTTGTAGAAATATAC
TGTTACTAATGCCAAATAAATGACCACTTTAAAAAAAAAAGTATCTTTTACACTGGTCTT
TTTTTTTTTACTCTAAAAAGTACCCATAAAATATGCTAAGTAAATAATTTTTCTTTTTTT
CATTTGTTAGTAAATAATAATTTTAAATCACTCTAGTGGAAAAAATAGTGACTTAGAAGA
CAACTGCAGTCACATGTGTACTGTTTCTTATCTCCTTGTGATAGGTGCCTATACACCTCA
TCTGCCACCAACTATAGTTTAAGCACTTCAAGATGAAATTGCCATGTTAATCTGTTTCAT
GGGTCTCTTAGAGATAAAAAAAAAAAAAAAAAATTGACAAATTTGATGGTTCCAATGCTA
AGGCAATAGATATTAAGCAGTTCTTTAGGACAATAAGTAAACAACAGAGGTATTAGAAAA
TGAGGGGAGAAACCTGTCGAGACAAAACAAACACACACAAAGCCACTGCATATTCTGGAC
TGGCATAGCCATTAACCTCTCCTTCAGTGCTTCCAAAGGTCAAGAATACACTTCACTGAG
AAGTGTTATGTACTCATGAAAACTGTAAAAGGTGAAAATATAAGACTTTTATGAAAAGGA
CCAAACAATTTTATTTATTCTCACTGACTACTATCTGATCTACCACAAGACCATTCCTAG
TGATTCTGCTTGGCACATATACTGAGGTAGTTTTACACAACCTGAAGCAAGGGAAGGATG
TTTACTGAGCTCAATAAACTTAGGTCATAACTGGTTTCACTTCACATAGTCAAATATGGA
GGAAAATTCAATAAATCTGTGACCAGACTTGTGTTATTCTAACAGATTTCCGATGGAATG
TCTGAAAGAGGCAGTCTTTTTTTTTTTTTTTTTTTTAACAGGAGTATCTACATCTGAGTC
TGGACTGACAGGGACCTACCCATGGAGTTATTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved