Erinaceus_europaeus Locus Mono:362:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:362:SNORA70
Erinaceus_europaeus
Mono:362:SNORA70
scaffold_305235
SNORA70
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAATAAGTAAATGAA
TCACATGTCATATATGAGTTCATTCACCTGAAATGTCCAAAGTTAGGCAAGGTTCAGTGG
TTGTTAGGTGAAGAGAAGAGATAAAGTATAGGGGTGAGGGTAGTGGCAAGGGAGAGACTA
TTCAAGCTCATAAGTCTTTCTGGGGATGGTAGAAATAGGCCAGAATTAGTCATGGTGGTG
ACTGCACGAGCCTGCCTATATACTAACAACAATGACATGGGCTTTTTAATTTTTCTGTTT
GTTTGCTTACATAGAGAGGGAAAAAGAGAACACAACACTGTCTGCAGCCAGTTAAGCCAA
CCGTGCTGCCCTCCCCACGGTGCCCGGTGTGCAATGGTTGCAAACAGCTGCCTCCTGGGT
AGTGTGTGTGCCTGGTGCTTATACAGGCTGCCCCAAAGGACCCTGGAAACAGCCCTTCCT
GCTCCCTATTCACTTTATGCCCGACTCTCTGCTGTCCCTAACCTTAGGCTCCAGGAAGGG
ATGCAGGGTGTCTTTGGGAAGCCCCAGGTCTCTGTGGCCAGGGTCCACATCAGCCATGTC
ATCATGTCCACCTGCACCAATCTGCAGAACAAGGAGCATGGCCTTGCACAGGGCCAAGTT
CAAATACTCTGGACGCCAGAAGATCCACATATCCAAGAAATGGGGCTTCAACTTTAATAC
AGATAAATTTGAAGACATGGTGGCTGAAAAACACCCCATCTCAGATGGCTGTGGAGTCAA
ATACATCCCCAACTGCAGTCTCCTGACAAGTGGAGGGCCCTGCACTCCTGAGAGCCTCAG
AGATGTTCCCTAATCAATTATAATAAATCAAGATCCTGCTTTAAAAAAGAGAGATAGACA
AGCGTTGAAGCAGGTCTGCAGGTGTCTGTCTTTCTCTCCCCCTCTCTGTCTTCCCCTCCT
CTCTCTACTTCTCTCTGTCCTATCCAACAACAATGATAGCAATAACAACAACAATAATAA
CTACAATAAAACAAGAGCAACAAAAGGAAATAAATATTAATAAAATAAAATAAAATAAAA
AGAGAGAGACCACAACACTGAAGCTTCTTTTCTTTCATTCTTTTTCTTTTTTTGCCCAAA
TGTTTGGAGCTTCACACATACATAGTACCATTGCCTTGGTCAGTTTTTCCTTTCTTCATT
CCAGAGAAGGAGAGGACAGAGACAGAGATATAGAGACAGAGAGGGAGAGAGAGGTAGGGG
GAGGTGGGGGTCCCTGCAGCGGCAACACACTCAATTCAGTGCATATAGTACCATACGCAA
GGACCCGTGCAAGAATCTGGGTTCTAGGCCCTGCTCCCTACCTGCAGCCGGGATGCTTCA
CAAGTGGTGGAACGCAAGGCAGCAGATGTCTCTCTTTTTCTTTCCCTTTCTATTTCCCTC
TCCTTTCTCAATATCTCTCTGAGATATTGAGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved