Erinaceus_europaeus Locus Mono:413:SNORD95
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:413:SNORD95
Erinaceus_europaeus
Mono:413:SNORD95
GeneScaffold_3613
SNORD95
1001..1067
2067
AGGGTTAACTCCTCTGAAACACCTGCTGAACTTTCACTGGGCTACATTCGCCCTCCTCT
GAACGCTCATCTGCAATGAGACAAAATGACGAAATACAGCAATCAATAAACACACGGGTC
AATAAACATTGCTCTCTTCCAATTCAACAACAGCACTTCTAGAAAATCATATTGAGAAAA
AAATAAAATATCCAAATACAAGAATCTGGATTACAATATTGTTTCTGATAGCAGGAGACT
GAAAAAAAAAACCCAGATTTGGGGATTTATAGAATAAATGATTTTCTAGGTGGAAATAAC
CATTATAGGATAATGGTTATACAAACAGACTCTCCTGCCTGAGGCTCCAAAGTACCAAGT
TCAAGCCCCAACACCACCATAAGACGGAGCTGAATTTACCAGTGTTCTTATAAAATAATA
ATAATAATAATAGATTATTTCCTGCCGATAAAAAAAGAACAAGGGATTAAAAAGAATGAG
GTAGACAAGTAATGATACACATGATATATTGTTATGGTAATTAGGAATTGCAGACATCAT
TTTTGCTTTAACATTTAACAAGTGCGTGGGGTAGATAGCATAATGGTTATGAAAAGAGAC
TCTGTGCAAAGCGTAAGGACTGGCTTGAGGATCCCGGTTTGAGCCCGTATTTAACCCGCT
GTGCTACCGCCTGGCCCCCTGCAAAAAGATTTTCATACCTGAGCCATCAAAGGTATGAGT
AACTCCCCAGCATCATCATAACCCAAAGCTATGCTTTGCTCCAATAAAAAAATAAAAGTA
AATAAATAAAAACTGGGTAGCAGTGCACCCAGTGGAGCACACATATCAGCGTGTGCAATG
TCCCAGGTTCAAGTCTCCAGTCCCCTTGTTCAGGGTGGAAGGCTCCTGAGCAGTAGGCAG
TGCTGCCGGTGTCTCTCTGTCCCTTTTCACCATCCCCTTCCTTCTTAATTGTTCTCTGTC
TTTATAAAAAGAGAGAGAGAGAGGAGAGGAAAAAAGAGTAAGTGTGGTGATGATCGCAAC
ATGCTCTATGAGTGTCCATGCTGAGAACCAGAGGCTGTCCCTGAGCTACAAAAATATAAA
AAATAGGTAAGTCTAAAAAATAAATGTAGGGCGGAGAGTAGATAGCATAATGGGTATGCA
AACAGACTCTCATGCCTGAGGCTCTAAAGTCCCAGGTAATCCCCCGCATCAACCATAAAT
CCAGAGATGACAGGGCTCTGGCTAATAAAATAAATAAAATAAGTGTACTAGTAATTAACA
TTGTAGATTGTGGTTCGCGCAGGTGCCAGAACGTGTGCCCTATTTAGACAAACAAAGGAA
TGAGCTATTCCCAAAGCACGCATGTTCCTTCTGGAGAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved