Erinaceus_europaeus Locus Mono:501:SNORA26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:501:SNORA26
Erinaceus_europaeus
Mono:501:SNORA26
GeneScaffold_4276
SNORA26
1001..1103
2103
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCCTTTAAGGTTGATGC
AGTGCTTCAAGATGCTACACGGAAAAGTAAAGAAAAGCTCTAGAGAAGAGGTTGCAAACA
CTTCTTTGGATCCTGCCTGGAAATCACAATTTTAAAAAGGAGTAAAGAAAGTATCAGGTA
TTCCAAAATTAAAAGAAAATAGTGTTACGTTTGGAAATATCTTGTAGGATAGTATAATGT
AGAGAATTTATCTTACCAATTTTAGATAGCCCTCAGCATCAAGAATTAAGTTTTCTGGCT
TTAGGTCTCTGTAGATAATACCCAGTCGATGCAGGTAATCAAATGCTTCTGTCACGCAAG
CCACACAGAACTTAGAGGTGGATTCATCAAAGCTGCCTCTGTAATGAAATTGATTTCCCT
CTTAATACTCTAGACATACATTGTCACTGTCTGCTTGAGGTATCAACTGTTGTATCAGTA
AATCTCTGCAATATGACTGCTTGGTAAGGCATCAGCACTATATTTTATGTTGATAATGAA
TTAAGACTGCTTACCAGAATTTAAGGAGCTACTTGATGAAAACAGGAACCAAGATTAAAA
TATTATCATTCAAATAACTGTTTCTAATATTCACATATGAAGGTGTAAACCAGAATGACA
AGAAAACAAAGACTTTTGGGGCCAGCTGGTGGTGCATTTGGTAAAGCACACAGGTTATGA
TGTGCAAGGATCTGGGTTTCAGTTTCTAGCCCTTACTTGCAAGAGGAAAACTTCAGGTAT
CTCTCTCTCCTTCTCAATTTCTCTCTGTCTCTATCCAAAATGAATAAAAATAATTTATTT
TCCCTTTTTTTGCCCTTGTTTTTTATTGTTGTTGTAATTATTCTTGTTATTGATGTTGTC
ATTGTTGGATAGGACAGAGAAATGGAGAGAGGAGGGGGATACAGAGATGGGGAGAGAAAG
ATAAACACCTGCTGACCTGCTTCACCGCCTGTGAAGTGACTCCCCTGCAGGTGGGGCAAC
AGAGAGGTGGGTGGGGGTAGAGCAACGGGGGGGGGGGGTTTGAACCCGGATCCTTGCGCT
TTGCGCCACATGCACTTAACCCACTGCGCTACCGCCTGACTCCCATAAAAATAATTTTTA
AACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved