Erinaceus_europaeus Locus Mono:440:SNORA17
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:440:SNORA17
Erinaceus_europaeus
Mono:440:SNORA17
GeneScaffold_8165
SNORA17
1001..1129
2129
TGGAGCACATGGGGTTCTGCTATGCAGCATCCTTGATGACAGGAATGACATCCTATGCA
TTGTTGTCATGTCCTCCATTGTTGACACAGTGCTGGTGCTTATTGGGGACTCCACTGTGA
CCAAATGAAGAATGTATGACTCCATGGAGCACTGCTATCTCTCAGGAGCAAGTCAGCCCA
TGGAAGAGGAAGGAGGAGTTTGGGGCTCAAATGAGGACTCAGGAGGAAAGACAGAGACAA
AAAGGCAGAGAGAGAATGAAATAGACCATAACATTGAAGTTTCTTTCAATGTGGTAGAGT
ACTATCCCCATTTTAAAGATGAGGAAGAAGAGGCAGGTTGCAAAACTCAACTCCCCCAAG
ATCAACTTCCAGTGGTTTAAAGTATGGGAGAAGAGTTTCCCAGTCTGCCAATACCTGCTC
TAATAGACACATTCAGCAAGTCTTTGCTGTGGCTGGGTCCTGGAATGGGACTTGAACTCT
TGTGGGGCCTGAAGCAGCATTTGCCATAAAGGGGCCGTGTACTATTTGGGTATGTGTCCT
ACAGAGGTGAGTTTCCAAGGGAGCTTTGGAAAGCCTCACAGCAAACAGAGTAGTGCCTGA
GACTTTGAGGACCTTGTTTTTATGCTCATATACCCCCTCTGGTTTTTTGTTTGTTTGTTT
GATTTGGTTTTTTTTTTTTTTTTAAAGATTGGAATTACAATATGCTTTGTGTACTTTTTC
TCAGACGAGACCTCCCACTTGTAGAAGTTTCAGGCCTGGATATGTCCTAGTTACATTTCA
TCTTTCATCAGAAGCAACTTTCTTCCAAGGGCAGGGCCTGAAACTCCCAGCATCTCCCAC
CACATAAGGTTAAACAGACTGGGGAGATGGCACAGTGGCTGTTCAGCAGACTTTCATGCC
TGGGGTCCTAGAAATGCCACGTTTAATTTTTGGCACCACCATAACTAGAGTTCAGCTGTG
CTCTGATATCTTTTTTTCTCACATTAAAATACAATAAATACCCTGACCCTAGAGGCATTA
CAGATGTGACTGCTGTGTCACATGTGTGTCATTAGGTGGCAGAGAGAAGACAGGCTCTAC
ATCCAGTGCTCTGACCTTTGAGCCACTGGGCGACTGATAAGTCTAACACTCAACACAGTG
CCCCTGCCAGTTACTGCATGTTTATTGGTGACCTGAATCCTGTCATGTAAAAGCTCTCAT
TCTTCCTTCGTTCCTGCCTGCCCTCAAATCTCGAGGTGACCCTGTGACCTGAAGACTGGT
GTTTATCCCTGCTGGATGAAGAGTGATGGCTCACCATTCAATGGGAAGGTGACTGCTAGC
CTGTGACAGTGACCATATGGAATGTCTGACTTCTGTCAACGCCTAGGTTACAAACCAGTC
CGGTATCCAGTGGTGGTGTTAGTAGTCACCTGAGAGATCTGATCACCAAATGGTGTGGTG
ACCTTACCAGACAGACCAGTACACCATCCTCAGTCTTGTAGCAGATGCCAAGAATTCGAC
CAGGAAAATTCTGGAAGGCTACTCTGCATCCTCCAGAGGAGTTCACGCAAATCATGGGGA
TCCACAGCTGACCAAGTTCAGGGCCTCACAGCACTGAGTACTCCCCCACTGCTCTACTAG
CTCATGAATTTGGGAGGGAGGGGCTATACTTTGTCCCCAAAAGGAAAATTAAAGGGACTT
TGTAAAACTTGAAAATAAACTTCTGACTTGTATGAAAAAAAATAAGATAAAATACAATAA
ATGAAATCCTAACCTGATAGGATGAGGTATGTAAAATGTACTGTTAATTGACAGACAAAA
GTCCACAACTGCAAATGCTATTGTCCTGTGAGATTCTTTTCATTGATGGATTTTGTTCCT
GTGAGATCCCTTTCACTGATTACTTTGTTCATCAAATATATTAATTTTGCTGAGTGTATC
TGTGGATCAGTTATCTTCTGTACCTTCTGGAACAGCTTCGAACCAAAGTAGAGAGGTTAT
TCAGCCAGAGATAATGAAAGAGAATCAGAAGGAGACAGGCAAGCCCTGTCAGTTCTCTGA
GCCTCAACATCTCCCTTCCTCATACACACACTCTAGATATGGAGTACCAACACTCAACAC
ACCAGGCTACTGTAATTGATCTAAGCTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved