Erinaceus_europaeus Locus Poly:8:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:8:SNORD116
Erinaceus_europaeus
Poly:8:SNORD116
scaffold_237362
SNORD116, SNORD116
1001..1100, 3480..3577
4577
CAGGCAAGGTGGTAGGCAGATATCAGTGCCGGAAGGCACCCAAGCCAGAGGGCAATGGT
CAGGGATAGCAGCGCAGAGGCCAGCATCAGCAGGAGGCAGTCCAGCTGGGTCTTCCCGAG
CAAGGGACCAGAGCCCAGCATGCACCCAGCTGATGCGCACCTGTGTTGTCTCCCCACCTC
TTCAGGTGCATTAGGCTGCCAAGCGGACTGGACAACCCTCACCAGTCCAAGCCGGCAGCC
ACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAGGCTGGCAGGCAGGCAGGC
AGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCCGTGGTCAGGGC
TAACAGCGCAGAGTCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGG
CCCAGAGCCCAGCATGCACACTGCTGACGCAAAGACGTGTTGTCTCCCCACCTCTCAGGT
GCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCC
CGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTG
TGCGCAGCCTGGCCAAGGACACCTCCCTCAGGTAAGCTGGCCTTTGTCCCTGGGCAGCTG
GGGCCTTGTTGGGGACCTGCACCAGGCCTGGCAATGGGTCGGCCTGCAGGTGAGGCTGCT
GTTGATGCTGTTGTAGCGCTGGTGCACAAGGCAGTGGCCGTGGTGGCAGGCTGCAGTGTG
CTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGT
GGGAGCTGCAGGGAGGTGCTGAGCCTCTCAGCTTTTCCCTGAGCCGTGGCCGGATCTGGA
GCCGAAGGCGAAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGG
GCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGGATCGATGATGACTCCCC
ACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCCTCCGTCTA
TCTCATCGGTTTCTGAGGTCCATGCGGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGA
GGAGACACATGCCTGTGCCGGGGTCTGCCTGGCGTGCCCTGGGCTTTGCCTTTGCCTTTG
CCTGTGCCTTCTCTTGCCTTTGCCCTCGCATCGCCTTAGCTCTGCATAGCCTTTACTGGA
GGTTTACCAGGGCCTCACCTAAACCTGTCTTGGGCCTAAACCTCCTGGGCATCACACTTC
CCACTTCCCACTCCCACTTCGCACTCACGGGTCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTCTCCCCACCTCTCAGGTGCATTTGGCAGCCAAGCAGACTGCACGACCCAGTCGGTGA
GGCCAGGCGAGGAGAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGA
GGCTGGCTGTGGCGGCTGTGTGCGCAGCCTGGCCAAGGACACCTCCATCAGGTAAGCTGG
CCTTTGTCCCTGGGCAGCTGGGGCCTTGTTGGGGACCTGCACCAGGCCTGGCAATGGGTC
GGCCTGCAGGTGAGGCTGCTGTTGATGCTGTTGTAGCGCTGGTGCACAAGGCAGTGGCCG
TGGTGGCGAGCTGCAGTGTGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGC
CTGGGCTCCTCAGGCCCTGTGGGAGCTGCAGGGAGGTGCTGAGCCTCTCAGCTTTTCCCT
GAGCCGTGGCCGAATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCA
TAGACAGAGCCTGAGCTGGGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGG
GGATCGATGATGACTCCCCACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGT
GAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGTCCATGTGGCACATGGTACGACCCT
GAGGCAGCAGGAGTGAGGGACACATGCCTTGCTGGGTCTGCCAGGCCTGCCCTGGCCTGG
CCTGGCCTGGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTG
CCTTGCCTCGCATCGCCTAGCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACCTAAC
CTGTCTTGGCCTAACCTCCTGGAATCACACTCCCACTCCCACTCCCACTCCCACTCGCAC
TCACAGTCCGTCAAGTAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGG
AGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGAAGCCAGGGTGGTAAGGGTCA
GTCAGGGAGTGCAAGGCTGGTCAACAGGTCTGTGCTGGCCGCCTTGTGGTGGCCTGCATG
GCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGCATGGTTC
TCAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCATTGTCCTG
TATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAGGCTCCAGGGGTCAGAACCA
TGGCCCTGAGTCTCAGGCCTTAAACGTACCTTCATGAGGCAGAGGGAGTTTAGCGGTGTG
GGGTGTTTCCGAACATGCAGCTTGGGGACAGAGCAAGAGTTAGACAGTTGGACTGGGTCC
TGGGATCGGGGGTGTGACCCTAGTCCTGACTAGTGCTCAGGCAGCAGATGGGAGAGGGAG
GCTGGGCCTGGGCATGGGCATGGTCCTGGGCCAGGGCCTGTGCCAGAGCCCAGGTCGCGC
TTGGTCCCCTGATTTTGGGGCAGCCTGAGTTGCAGGCCCCATTTGTGCCTGCCGTGCCCA
AGCAGGAAGGCTGGTCTGGTGGGGAGGTCGCACAGTGGTGATGAGGAGGCCCTTGCATGG
GGTATTTGGGCCCCTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved