Erinaceus_europaeus Locus Mono:37:SNORD26
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:37:SNORD26
Erinaceus_europaeus
Mono:37:SNORD26
scaffold_289226
SNORD26
1001..1076
2076
TTTCCTTCTCCCATAGGAAGACTTCCCCCATCACCAACCCTTCAATTAGCTACCCTCCT
GAATGGTATTGTATACTAAATTGGAAATAACATTGATATTAAGGTCAGTTGTAGGTTCAA
ATCTCAGTTCTGCCACTGATTAAGATTCCAACCTTACACAGGTATGTCAGGATGGAATCA
TAGTAGTGTCTGCAACTTGATGACTGAAAAGCAGTAAGATACAAACCAGGACTAATTGCT
GCCCCAACCTCTCCAGAGCCCTACCCAGCTAGGGACATATAGAAACATTCTGGGGTTATG
GATCCACCTGCCAACACTCATGTCCAGCAGAAAAGCAATTATAGAAGCCAGTCCTTCCAA
CTTCTACACCTCAAAAAAGAATTTTGGTCTATAGTCCCAGAGGGTTTAAGAATAAGGAAT
TTTTATTTTTTTAATTTCTTAAATATATTTTATAATTATTTATTTATTCCCTTTTGTTGC
CCTTGTTGTTTTATTGTTGTAGTTATTATTGTTGTTGTTATTGAAGATGTTGTTGGATAG
GACAGAGAGAAGCGAAGAGAGGAGGGGTAGACAGAGAGGGGGAGAGAAAGATAGACACCT
GCAGACCTGCTCCCCCACTTGTAAAGTGACCACACTGCAGGTGGGGAGACAGGAGCTCAA
ACTGGGATCCTTACGTCAAGTGTGCTTAACCGCTGCTCTATCACCCTATCCCTAAGAATA
AGGAAGTTTCCAATGGAAGAGATGAGACACAGAACTCTGGTGGTAGGAACTGTATGGAGC
CATACCCCTGTTACCTTATAACTGTGTTAATTATTATAAAAAAATCACTAATAAAAACTA
AAAAATGAACCTACTAAAAAAAGAAGATTTTGACCTTACTCAAGTTATCCAAAGTCTCTG
AATTTAGTTAATTACTTAATTCTCCTGTGAATTTGTCACCCAATATAAATAAAAGGTGTG
AGTGCAGTACTATATTCCTGGTAGACTTAGAAAATCAGTCCTTGTGGGGATGATTTCCAC
AATTGAACTCTCTCTTTCTCATGGAGTAGTGAGAGATTATAATACATTCTGAGTAGAAAA
AAAAAAGAAGAAGAAGAAGGGAGTCAGGTGGTAGCTCAGACTATGAGGCAAAAAGTGCAC
GGACCTGCATAAGGGTCCCACGTTCAACGACCTGGCTCCCCACCTGCAGGGGGATCACNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTGTTTATGTACACTCCTAG
TAAAGTGTAGTCATATAAATCACTAGTTAATTAATATAGAGGGGGGGAATTAATTGTATG
TCTCAAAGTTTTTAAAACACAGAATGAGTCTTTGTAATATATAGGCTGTGTATTTGATAT
GTGGACTCTCTCAAAAGCCTAGACCAAAGTAGATCAGAAAGCAACCAATGGCACAGCTAT
ATACAAGATACTGGGTACTATACAGCAAACCCTAACAAAAGGACTTTTCAAAGTTAACCC
AATTACCAAATAATGTGTTGATAACAATAACTATCCATTGTCTTTTTGAACCCTAAGATA
GCAGGAACCTCACATCTCCACTATGGAGCCTATATTTCCCCCAGTACTGGAACCTTAGGA
TAGGACCCACTTTCCTGCATGCCTCTCCCAATTCATATCAAATATTATTGTATCAGCTGA
TCGCAACCCAATCAACGCAAGGATTGCCACCTCAACATGCTTCAGTTCAGACTGTGTCCA
GAGACTTCACGTGTGGAATGACAACCCTTCAGCTTCATTACTCGGGTGAGACCTTCCTTT
CATAGTATTCTCTAATTCCATCCCAGGTGGTTCACTTTCTAACAAAGACCCAAAACCTAG
ATATAGAACAGGTTCTGTGAGAGAGAGCTTATGTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved