Erinaceus_europaeus Locus Mono:291:SNORD95
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:291:SNORD95
Erinaceus_europaeus
Mono:291:SNORD95
scaffold_70069
SNORD95
1001..1067
1389
GAACTTCCACTGGAAAGAGCCACCCTCTCCACTCACGTAAATGTTAACAATTTAATAGT
CCACTTGCGCACAATTTATTATTTTCAAAAATTAGCACCGTATTTTTCAGATTGCCACGG
TTACTCACAGTTGCGACGTCGAAATCTAGCTCGCTTTTCGTTTTCCTCCGAGCCACCCAG
CGGAAAAGGCGGTGCTCTAGCGGTGCCACATAGGAGCAGAGAAATGCCACATAGGGGCTC
AACGCGTTGGGAGGTGTGGGGGGCACTTCCGGTCACCGCATCTTTAGACTTCAGGTCCCA
ATCAGCATCTCAGCAGGCTTTTTATACACCCAGTCGTGCTGGTTTTAGAACGTGAGTGTC
AGACGTTGCCACACCGTGGGCCAGAGAGGAACCCGGCTCCTGTGACTCTTCCTAGACACT
AGAGGGCGCTGCCTCCTGGAGAAGTGAATCATGGGGACCGCCATCTTTCTCCGGTGAGCT
GGTATTTCCGCTTCCGGCGGCGGGCTGCTCGGTCTTTTTCTCGGCAGGGCGGCGGCGGGA
GCGGCTGCGGTGCTCCTCTCTCTGAGCCATCCAGTCTCATCCTTGTCGCTGCGGCGACCC
CCGCGCCCGCCGTCACCATGACTGAGCAGATGACCCTTCGGGGAACCCTCAAGGGCCACA
ATGGCTGGGTAACTCAGATCGCCACCACCCCGCAGTTCCCGGACATGATTTTGTCGGCCT
CTCGAGGTATGGAACAGAGGAGGGAAGGGGGTGGGGTGGGGGACTCAAGCTGGCGCGCTT
GGCGAGCTGGGGCGGGTGGTGGTGCGGTTCTGCGGGGCTTGGAAACTCGGTCCCGGTGCG
AGTTGGTAAACGCGGCCCCGTGCCTAGGCCTTTGCATGGACAGACCCGGGAGTGAAAGAC
TAGGTGCCGGCAGTGTTGAAGAGTCGGATGTTTTTCTTTTTCATTTTGTCCTGCTCCGTG
CACGTGTTGCTGAGGGTGCCCCGGAGCCTGGGAGTCGGGCGGTGCGGTGATGATCCCCAA
CATGCCATCTGAGCGCCCTTGCTGAGAACCAGAGCTGTTTCTGAGTTGCCGCCCGGCGGG
CCCACATCTACCCTCCACCTGTCCCCTGCCTTTGGCCACGTCCGTGAGCTACGTTTGAAG
CCTCTTAAGCTGTCGTTTTTTCCCCAGCAGGGAGGGTCATGCTGCCACAGACCTGGAAAC
TGTGGAGTGACTGTGATTCGTGAAACTCCCATCTAGAGAGATGATCCATGTTTATCCACT
TCTAGCATTTCTAGATGAAAGGAGAGATCAAGCTAGACTGCGACCAAGTGTGTTGATAAA
TTAAGTCAACTCAAACCAAATGTCCGTGCAGAAGTGATTCGGCCGTTAAACGAGCCTAAT
TGCTTAACCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved