Erinaceus_europaeus Locus Mono:308:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:308:SNORD116
Erinaceus_europaeus
Mono:308:SNORD116
scaffold_163761
SNORD116
1001..1098
1479
CATCCGGCCTTTGCTTCCCTGCAGAGGGCAGTGTTGTGCGCACTGAGGAGGGTGTGAGG
GCATGGGGGTGTGAGGGCCCCAGGGCTGTGTGGCTTAGACCCAAGGCTTGCAGACTGTTT
GTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCCCGC
CAGCAGCATCCCTGCATTCCCTCTTGCATGCACGCACTCATACACGCCAGGCACCCTCAC
CAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAG
GCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGG
GCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATG
GGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAG
GTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAAGCCAGGCGAGGAGAGGT
CCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTG
TGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGC
TGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGACGGCT
GCTGCTGATGCTGTTGTAGCGCTGACACACAAAGGCAGTGGCAGTGGTGGCGAGCTGCAG
TGTGCTCCCACGGGGACCCACTCTCTTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCC
TGTGGGTGCTGCAGAGAGAGGCTGAGCCTCTCAGCCTTTCTTGAGCCGTGGCCGGATCTG
AAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCG
GGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCC
ACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTAT
CTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGG
ACACATGCCTTGCCGGGTCTTGCCTGCCTGCCCTGGCCTGGCCTGGCCTTGCCTTGCCTT
GCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCATCGCCTAGCCCTGCATAGCCTTACCGA
GTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCACACACCCACTCC
CACTCCCACTCGCACTCACAGTCCATCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCA
AGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCA
GGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved