Erinaceus_europaeus Locus Mono:115:SNORA71
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:115:SNORA71
Erinaceus_europaeus
Mono:115:SNORA71
scaffold_356340
SNORA71
1001..1133
2133
TTTTGGCTGAAAATCAGCACAGCGTGGGTCAAAGTGATCAGCTTTTTAACTTTTATTCC
CTTTTGTTGCCCTTGTTTTATTGTTGTAGTTGTTATTGTCATCGTTGTTGGATAGGACAG
AGAAATGGAGAGAGGAGGGGAAGACAGAGGGGGGGAGAGAAAGACAGACACCTGCAGACC
TGCTTCACCGCCTGTGAAGCGACTCCCCTGCAGGTGGGGATACGGGGGCTCGAACCGGGA
TCCTTACGCCGGTGCTTGCGCTTAGTGCCGCTTGCGCTTAGTGCCACGTGCGCTTAACCT
GCTGCGCTACTGTCCAGCTCCTGATAAATATTTTAAAAGACTTTTTTGGGGGGTCCTAGT
AGTGGCGTACCTGGTTGAGCTCCCATTTATTTAAGACTGTTTATTGATGAGAAAAATAGG
AGAGGAAGAAAGAACCAGACATCAGTCTAGTACATGTGCTGCCTGGGATCGAACTCAGGA
TCTCATGCTTGAGAGTCCAGTGTTTTATCCACTGTGCCACCCCTCGGACTACCGTTTAAA
AAATACTATTTGTTTATTTTTGTTCATTTAGGTAACCTTGGTTTACAAGCCCATAGTGGT
TTTTTGTATTTTATTTTTGTTTATTGTGGGATAGAGACAGAAGTTGAGAGAGGAGTGGGA
GATAGGGAAAGAGGCAGAGAGACACCTGCAGCCCTGCTTCACCACTCATGAAGCTTTTCC
CCCTGCAGGTGAGGTCCAGGGGCTTGAACCCGGGTCCTTGTGCACTTAGCAGGTAGGTGC
ACCACCACCTGGCTCTTAATTGAACAGAAGGCAGCCAGAGTACTACTAAGGCAGAATGTG
GTTCTGGGATCAAACTTTTGACCTCGTTTATGAAAGTCCCTATGCACTACCAGCTGTGCC
ACCTTGTTTGAAATGAGATAGTCCTTGGGGTCCTGGGCTGTCTAGGCAGGGAGCAGACTG
CCAAGTAGGGCTTCCGCTCTGGGCTCCTGCCTGCTTTCTGCACCTGCATTCGAAAGTGAT
CACGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGGAGAGCAACTGCCAAAAGCGTTT
CCCCGTGTTTGGAGGGTCTCCCCTGTCCCTTCTGAACCCTGAAGCTTTCTCACACTTTTT
TTTTTTTTCTCCTCCTGGTGTCAATGGTATAGTGGCTGGGCTAGCCCTGCGCATTGCTTT
GTCTTTTCAGTTTAAGGATTCTCTTGTCAGAAGTTGGTCTTTGCACTTACTATCTGGACC
TTATACTGGAATACATTTAGATAATGCTTAAGGATACATGTAAACCATGGGTTCTGATTA
ATGAATTTATGGAAGTAGGATGATCTGAGACAACGGTGATGTAAATACTTGTGTGTTGTC
TTTACTCTTTTTCTTGAACACGTTGTTTATTGTGATTCTAAGAGCCATAGTAATGAATAA
ATGGAGAAAGAAAATTAACATCGGTGCCAGATGTTGGGGCAATTAGGAGGGCTCCTCTCA
GTTTCTGAGTCAGTAGAAGTGTTTCAGTTCCAGCACACCAGAGTCTGAGTAGTGCTTTGT
ATGGTTACTGACGAAGGAAGAGGACTGTCAGAATGTATTGGTATGAGGTCCAAATAGAAA
GTTACAGGCTTGTTTCTCATTAGCCTAATTGTAGGCAGTCCACCTTACGTCGACTTTTTT
TTTTAACCAGAGCACTGCTCAGCTCTGGCTTATGGTGGTACAGGGGATTGAACCTGGAAC
TTTGGAGCCTCAGGTAAGAAAGTTTCTTTGTATCCCCCACCCCCAGAATCTCCTGTGGAT
ATTTTTTTTTGGGGGGGGAAGGGTGAACCCTCTCTGGCTCATATTGAATGATTCTTTACA
GATTAGGATGACCTGGGCAGTCAAATAATAGCAGGTGGGGAAGAGGTGTTGAATAATTTG
ATGGGTCCCTTTCCCTTTGGCCAAGCTTTGGTGGAAACTGGGTGTCGGCCCAGCGGCACT
GAGCTGTCTGTCCTATGGATTCCAGGTCACCCTCTGGATTACTCTACGTGGCCGGTTGCT
TTCATTATGGATTGCTTATAAGAAAGCCATTTAGTGTTTTAAAAAAAAAACTAGTCTAGT
GTGTCTTAGACTAGAGAGATGGCTCACTGGTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved