Erinaceus_europaeus Locus Mono:498:SNORA62
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:498:SNORA62
Erinaceus_europaeus
Mono:498:SNORA62
GeneScaffold_4654
SNORA62
1001..1161
2161
TGGATTATAGCATTAGATTCTACATCCAACTTAAAATCTCCATTCTCATTGATATGAAT
AATATCCTCACCACAGCAACCTTCAAGAAGAGTCTATGGAAAATTAACATCAATAAGAGA
AACATTAATTTAAAAAGCAACAAAACATTAAGCTTTCAATCTTAGCAGTCATAACATTAT
ATAAGCAACATTTTAAAGTGTCTTTGCTTTGCAAAGCTATTCAAATAGGTAATTCAAACT
TTCAGAAATTTGTAATTACTGCTCAGTCTCAAAGATAGGACATGAAAAGCCACATTATAT
TTTTACTAGTTAAATTTGATGAATCTGTGAGGCCTTAATAACCATATTACAAAGAGAAGA
ACAGTAAGTGTTGGAGACAGTGTGTGGAAAGAAAGGAACCTTTGTGAGAACATGAATCAC
TGTAACCAAAATGAAAAATAGCACGGAAATCCTAAAAACAGAACTTCCATATGATTCTTC
AATTCCATTTCTAATGTAACTTTTACAAAAAACACTAATTTGCACCCCTATGTTCACAAT
GGCCAAGATATAGAAACAAACTAAGTGCCCAGTGACTGCTGAATTGAGAAAGCAGAGATG
GTAAATACACAAAATGAATATTACTAAACTATTAAAGAAATGAAATTCTGCCACATGTGG
TAACATGGATGGACCTTGAGGAGGTTAATGCTAAGTGAAATAAGACAGATTTCACTCAGG
ATGTGGAGTAAGAAGATATACTACAAGTGAATAAACAAAACAAAGGCTAACCATCAGATT
CTGACAGAGGGAAAAAGAATCAAGGGAGGGAGTGGGAAGAGAAGGTTGAGTAAACAGAGG
TAGATGGCAACTGAAACTGGTAGTGGATATGGCGTGGTACCAGACATTTGAAGAGTCGTG
AAACTGCACTCCTAAATCAGATATAGTGTGCTAAGTCAATGATAACCTCAAAAATAAATA
AACCAAATAAATAAATAAATAAATAAATAAATAAACCTTTCCCTGCACACCATTAAAACT
CAGGGTAGAAGCCAAAGAACTTCTGAGTTTTGGCCAATGAACTTCTGACTGTTGGTTTCC
TGTTAGATGAACTGCAGTAATTTGCTAGCACCAGTAGAGCTTGTCTCTATGACTAGAGTT
TGATAGTACCACTCCCACATTCAACTTTTTAGAAGACTGTTCTTTTCTTTCCTTTTCCTT
TATTTTCTTCTTCTTCTTCTTTTTAAATTTCTATTTATTTGGTAAAAACAGAGAGAAACT
GAGAGTGAAGGGCAAGAGAGACAGACACCTGCAATACTGCTTCATTACTCCTAATGCTTT
CCCCCTGCAGGTGGAGACCAGGGGCTTGAACCACATACATTCAACCAAGTATACCACTAC
CTGACCCCAACTGTTCATTTCTAAAGCTGTGTCAAGCATTAAGTTTTCTGCTATCTCCTG
AAAATTTTTTTCCCCAAATGTGTTATGAATTCATGCCATAGTTGTATGAATCTTCATAAC
TAAAATAATTGGGGGAAGGTGGTAGAAGACTAGCTCACTAGATGGGACACCTACTTTATC
ATGAATAGGGCTCAGGGGTGAGTTCCGGCACACCACTTACAATGGTACTGGGGGGAATTC
TAGTGTCTATTACCTCTCTCTCTTTGAATGAAAAAGTTAGTCAATAGACTGACAAAGCAG
TGGTGAAGGTACACATACATGAGGCTTCAGCAAGTCAAAGAAAAGAAAGAAAAGGAAAAG
AAGAGAAAAGAAAAAGAGTGAGGGGCCAGTCTTGGACACATCTCTGGTTCATTAAAATTT
AAATTCTATGAGTTTATTTATTTCTCTTACTCTCCTAAGATGCTTTAAAGAAAAATAAAG
TGTACTTATTTAAATGGTAAAAACCATAAGAATATTTTGATGAACTACACACATGTGAAT
TACTTTCATTTTTCTTCAGGAATAACAGGAACACAAAACACTATTATTGGAAGACTTCAG
TAGAGATAAGTATCAATACATTTGAAACTATGAGATTAAGTTTTATTAAAATTGTACCTT
CAAAATATGAAAGCCAACAATGCATTTTTGTTTGATCAACACCTGATGAATCATGGAAAG
TCCATTACAATTTCCTAATTCATGTATTCTCTGTTGGTTGTATTTAATTAATAATAATAT
AA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved