Erinaceus_europaeus Locus Poly:7:SNORD116
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Poly:7:SNORD116
Erinaceus_europaeus
Poly:7:SNORD116
scaffold_347885
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1098, 3350..3447, 5832..5929, 8207..8304, 10612..10709, 12980..13077, 15384..15481
16481
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGACAGAGCCTGAGCCG
GGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCC
ACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTAT
CTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGG
ACACATGCCTTGCCGGGTCTTGCCTGCCTGGTTGGCCTGGCCTTGCCTTGCCTTGCCTTG
CCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCAGCGCCTAGCCCTGCATAGCCTTA
CCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCA
CTCCCACTCCCACTCGGACTCACAGTCCGTCAAGCAACCATGTCAGGCATTGTGGCCCAA
AGCAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCA
GCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGACTGTGCTGGCCG
CCTTGTGGTGGCCTGCATGGCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCC
GGGCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTC
CACCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAG
GCTCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGTACCTTCATGAGGCA
GAGGGAGTCCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAGTT
AGACAGCTGGACTGGGTCCTGGGATCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCAGG
CAGCCTATGGGAGAGGGAGGCTGGGCCCGGGCATGGGCATGGTCCTGGGCCAGGGCCTGT
GCCAGGGCCCAGGTCGCGCTTGGTCCCCTGATTTGGGGGCAGCCTGAGTTGCAGGCCCCA
TTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGGAGGTCGCACAGTGGTG
ATGGGGAGGCCCTTGCATGGGGTATTTGGGCCCCTGGAGGGCCAGGAGGTCACCTGGGCC
TTGATGACTTGCAGACCCAGCCTCTTGTCTCAGTCCCTTTCGTGGCTTGTGTGTGTTTAG
GAAGGAGTCTTTTGGAAGGCCTTATGTGCAGTCCAGAACAGCCAGGGTGCCTGTGAAGCC
TCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTGCACTGCTCCCCGT
GGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGGCTAGGCCAGGCTT
GGAGGGGTGTGCTTGGAGGATTTTGGACAGTCATCCGGCCTTTGCTTCCTGCAGAGGGCA
GTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCATGTGGGTGTGAGGGCCCCAGGGCTGTGT
GGCTTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGCAG
AAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCCTCTTGCATGC
ACGCACTCATACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGGCA
AGCAGGCAGGCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCA
GTGGTCAGGGCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTG
CCGAGCATGGGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCCCC
ACCTCTCAGGTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAAGCCAGGCG
AGGAGAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTG
TGGCGGCTGTGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCC
CTGGGCAGCTGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCTGCAG
GGGAGGCTGCTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGG
GCTGCAGTGTGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCC
TCAGGCCCTGTGGGTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGG
CCGGATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAG
CCTGAGCCGGGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGA
TGACTCCCCACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCC
TCCGTCTATCTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGCAG
GAGTGAGGGACACATGCCTTGCCGGGTCTTGCCTGGCCTGCCCTGGCCTGGCCTGGCCTG
GCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCATCGCCTA
GCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACATCC
GGCATCACACTCCCACTCGCACTCCCACTCAAACTCATATTCGCCATGCTGTAAATAGCC
ATGTCAGCAAGTGAGCCCAGAACAACTGGCACCGGTGGAGCTAGGGTAAGCCTAGGGTGA
CACGGCGGAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCGAGGCCGGTAA
ACAGGTTTGTGCTGTGCCGCCTTGTGGACACCTGTATGGCCTCAGTGTTCGAAAGCCCTC
TGAGTTACGTAGACCTGGCCCTCCACGCATGGGCATGCTTCTCACAAGGGGAGATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTTATGTGCAGTCCAGAACAGCCAGGGTGCCTGTGAAG
CCTCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTGCACTGCTCCCC
ATGGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGGCTAGGCCAGGC
TTGGAGGGGTGTGCTTGGAGGATTTTGGACAGTCATCCGGCCTTTGCTTCCTGCAGAGGG
CAGTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCATGTGGGTGTGAGGGCCCCAGGGCTGT
GTGGCTTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGC
AGAAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCCTCTTGCAT
GCACGCACTCATACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGG
CAAGCAGGCAGGCAGGCTGGCAGGCAGGCAGGCAGGCTGGCAGGCAGCCATTGGCGCCGG
CAGGCACCTAGGCCTGTGGGCAGTGGTCAGGGCTAACACCGCAGAGGCCAGCCTCAGTAG
GAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGGCCCAGAGCCCAGCATGCACCCTGCTGA
CGCACAGACGTGTTGTCTCCCCACCTCTCAGGTGCATTTGGCTGCCAAGCGGACTGGACG
ACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGG
AGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTGTGCGCAGCCTGGCCGAGGACACCTCCC
CCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGGGCCTTGTTGGGGACTGGCACTAGGC
CTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGCTGATGCTGTTGTAGCGCTGGCGCAC
AAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCTCCCACGGGGACCCACTCTCCCTGGA
CTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGTGGGTGCTGCAGGGAGGGGCTGAGCCTC
TCAGCCTTTCCCTGAGCCGTGGCCGGATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCC
AGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCCGCCTTCTGCCCTTTGGCAGCCTCC
CCGAAGGTGCTGGGATCGATGATGACTCCCCACTCACACCAGCATTCCTTGGAAAAGCTG
AACAAAATGAGTGAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGTCCATGCGGCACA
TGGTGCGACCCTGAGGCAGCAGGAGTGAGGGACACATGCCTTGCCGGGTCTGGCCTGGCC
TGCACTGGCCTGGCCTGGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCC
TTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCTCATCGCCTAGCCCTGCATAGCCTTACC
GAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCACT
CCCACTCCCACTCGCACTCACAGTCCGTCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAG
CAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGC
CAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGCTGCC
TTGTGGTGGCCTGCAAGGCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCCGG
GCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTCCA
CCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAGGC
TCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGTACCTTCATGAGGCAGA
GGGAGTCCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAGTTAG
ACAGCTGGACTGGGTCCTGGGATCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCAGGCA
GCCGATGGGAGAGGGAGGCTGGGCCTGGGCATGGGCATGGTCCTGGGCCAGGGCCTGTGC
CAGGGCCCAGGTCACGCTTGGTCCCCTGATTTGGGGGCAGCCTGAGTTGCAGGCCCCATT
TGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGGTCGCACAGTGGTGATG
GGGAGGCCCTTGCATGGGGTATTTGGGCCCCTTGAGGGCCAGGAGGTCACCTGGGCCTTG
ATGACTTGCAGACCCAGCCTCTTGTCTCAGTCCCTTTCGTGGCTTGTGTGTGTTTAGGAA
GGAGTCTTTTGGAAGGCCTTATGTGCAGTCCAGAACAGCCAGGGTGCCTGTGAAGCCTCC
TGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTGCACTGCTCCCCGTGGA
GGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGGCTAGGCCAGGCTTGGA
GGGGTGTGCTTGGAGGCTTTTGGACAGTCATCCGGCCTTTGCTTCCTGCAGAGGGCAGTG
TTGTGCGCCCTGAGGAGGGTGTGAGGGCATGCGGGTGTGAGGGCCCCAGGGCTGTGTGGC
TTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAG
CCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCCTCTTGCATGCACG
CACTCATACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGC
AGGCAGGCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGAACCTAGGCCTGTGGGCAGTG
GTCAGGGCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCG
AGCATGGGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCGCCACC
TCTCAGGTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGG
AGAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGG
CGGCTGTGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTG
GGCAGCTGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCAGCAGGGG
AGGCTGCTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCT
GCAGTGTGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCA
GGCCCTGTGGGTGCTGCAGGGAGGGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCG
GATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCT
GAGCCGGGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGA
CTCCCCACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCC
GTCTATCTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAAGCAGCAGGAG
TGAGGGACACATGCCTTGCCGGGTCTTGCCTGGCCTGCCCTGGCCTGGCCTGGCCTAGCC
TGGCCTGGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCC
TTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCATCGCCTAGCCCTGCA
TAGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCA
CACTCCCACTCCCACTCGCACTCACAGTCCGTCAAGCAGCCATTTCAGGCAGTGTGGCCC
AAAGCAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGG
CAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGC
CGCCTTGTGATGGCCTGCATGGCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGG
CCGGGCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTC
TCCACCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGA
AGGCTCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGTACCTTCATGAGG
CAGAGGGAGTCCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAG
TTAGACAGCTGGACTGGGTCCTGGGATCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCA
GGCAGCCGATGGGAGAGGGAGGCTGGGCCTGGGCATGGGCATGGTCCTGGGCCAGGGCCT
GTGCCAGGGCCCAGGTCGCGCTTGGTCCCCTGATTTGGGGGCAGCCTGAGTTGCAGGCCC
CATTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGGTCGCACAGTGGT
GATGGGGAGGCCCTTACATGGGGTATTTGGGCCCCTGGAGGGCCAGGAGGTCACCTGGGC
CTTGATGACTTGCAGACCCAGCCTCTTGTCTCAGTCCCTTTCGTGGCTTGTGTGTTTTTA
GGAAGGAGTCTTTTGGAAGGCCTTATGTGCAGTCCAGAACAGCCAGGGTGCCTGTGAAGC
CTCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTGCACTGCTCCCCG
TGGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGGCTAGGCCAGGCT
TGGAGGGGTGTGCTTGGAGGATTTTGGACAGTCATCCGGCCTTTTTTTTCCTGCAGAGGG
CAGTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCATGCGGGTGTGAGGGCCCCAGGTCTGT
GTGGCTTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGC
AGAAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCCTCTTGCAT
GTACGCACTCATACACACCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACTTTGGCAGG
CAAGCAGGCAGGCAGGCTGGCAGGCAGCCATTGGCGCCGGCAGGCACCTAGGCCTGTGGG
CAGTGGTCAGGGCTAACAGCGCAGAGGCCAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCT
TGCCGAGCATGGGCCCAGAGCCCAGCATGCACCCTGCTGACGCACAGACGTGTTGTCTCC
CCACCTCTCAGGTGCATTTGGCTGCCAAGCGGACTGGACGACCCAGTCGGTGAGGCCAGG
CGAGGAGAGGTCCCGGACCCACTTGGCGAGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGC
TGTGGCGGCTGTGTGCGCAGCCTGGCCGAGGACACCTCCCCCAGGTAAGCTGGCCTTTGG
CCCTGGGCAGCTGGGGCCTTGTTGGGGACTGGCACTAGGCCTGGCAATGGGTCGGCCTGC
AGGGGAGGCTGCTGCTGATGCTGTTGTAGCGCTGGCGCACAAGGCAGTGGCCGTGGTGGC
GGGCTGCAGTGTGCTCCCACGGGGACCCACTCTCCCTGGACTGAGCTCAGGGGCTGGGCT
CCTCAGGCCCTGTGGGTGCTGCAGGGAGGGGCTGAGCCTCTTAGCCTTTCCCTGAGCCGT
GGCCGGATCTGGAGCCGAAGGCGAAGGTGAAGCCGCAGCCAGAGACAGAGCCATAGACAG
AGCCTGAGCCGGGCCCGCCTTCTGCCCTTTGGCAGCCTCCCCGAAGGTGCTGGGATCGAT
GATGACTCCCCACTCACACCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACCC
CCTCCGTCTATCTCATCGGTTCTGAGGTCCATGCGGCACATGGTGCGACCCTGAGGCAGC
AGGAGTGAGGGACACATGCCTTGCCGGGTCTTGCCTGCCTGCCCTGGCCTGGCCTGTGCC
TTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTCGCATCGCCTAGCCCTGCA
TAGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTCTTGGCCTAACCTCCTGGCATCA
CACACCCACTCCCACTCCCACTCGCACTCACAGTCCATCAAGCAGCCATGTCAGGCAGTG
TGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTAGGGTATGGCCTAGGGTGTCCCCTGGCAG
TACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTGCAAGGCCGGTCAACAGGTCTGT
GCTGGCCGCCTTGTGGTGGCCTGCATGGCCTCACTCTCTAGAGCCCTCTGGTTTGTAGGC
CTGGGGCCGGGCAAATGGGCATGGTTCTCAATGGGGGTGATTGTGGCTTGAGCAGCCTGC
AGGGTCTCCACCCTTGCCATTGTCCTGTATCTCCAGGGGCTACGAGGAGCAGGGGGAAGT
TGGCGAAGGCTCCAGGGGTCAGAACCATGGCCCTGAGTCTCAGGCCTTAAGCGTACCTTC
ATGAGGCAGAGGGAGTCCAGCGGTGTGGGGTGTTTCCGAGCATGCAGCTTGGGGACAGAG
CAAGAGTTAGACAGCTGGACTGGGTCCTGGGATCGGGGGTGTGGCCCTAGTCCTGACTAG
TGCTCAGGCAGCCTATGGGAGAGGGAGGCTGGGCCTGGGCATGGGCATGGTCCTGGGCCA
GGGCCTGTGCCAGGGCCCAGGGTCACGCTTGGGTCCCCTGATTTGGGGGCAGCCTGAGTT
GCAGGCCCCATTTGTGCCTGCCGTGCCCAAGCAGGAAGGCTGGTCTGGTGTGGAGGTCGC
ACAGTGGTGATGGGGAGGCCCTTGCATGGGGTATTTGGGCCCCTGGAGGGCCAGGAGGTC
ACCTGGGCCTTGATGACTTGCAGAACCCAGCCTCTTGTCTCAGTCCCTTTCGTGGCTTGT
GTGTGTTTAGGAAGGAGTCTTTTGGAAGGCCTTATGTGCAGTCCAGAACAGCCAGGGTGC
CTGTGAAGCCTCCTGGGATCCCTGTGGTTCTAGTGTGTAAGTCAGCCTAGCTGGCTGCAC
TGCTCCCCGTGGAGGCTGTCAGGCTGTCAGGTGTGCAGGCAGAGGGTGTGAGCTAGGCTA
GGCCAGGCTTGGAGGGGTGTGCTTGGAGGCTTTTGGACAGTCATCCGGCCTTTGCTTCCT
GCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTGTGAGGGCATGTGGGTGTGAGGGCCCC
AGGGCTGTGTGGCTTAGACCCAAGGCTTGCAGACTGTTTGTGAAGGTAGCAGAGAGCTGG
TCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCCCGCCAGCAGCATCCCTGCATTCCC
TCTTGCATGCACGCACTCATACACGCCAGGCACCCTCACCAGTCCAAGCCGGCAGCCACT
TTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGGCAGGCAGGCTGGCAGGCAGCCATT
GGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGGGCTAACAGCGCAGAGGCCAGC
CTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGGCCCAGAGCCCAGCATGCAC
CCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAGGTGCATTTGGCTGCCAAGCGG
ACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCCCGGACCCACTTGGCGAGCC
AGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTGTGCGCAGCCTGGCCGAGGA
CACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGGGCCTTGTTGGGGACTGG
CACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGCTGATGCTGTTGTAGCGC
TGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCTCCCACGGGGACCCACTC
TCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGTGGGTGCTGCAGGGAGGGGC
TGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGGATCTGGAGCCGAAGGCGAAGGTGAAG
CCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCCGCCTTCTGCCCTTTGG
CAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCCACTCACACCAGCATTCCTTGG
AAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGTCCAT
GCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGGACACATGCCTCGCCGGGTCTT
GCCTGGCCTGCACTGGCCTGGCCTGGTCCGGTCACGCCTTGCCTTGCCTTGCCTTGCCTT
GCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTT
GCCTTGCCTCTCATCGCCTAGCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACCTAA
CCTGTCTTGGCCTAACCTCCTGGCATCACACTCCCACTCCCACTCCCACTCGCACTCACA
GTCCGTCAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTA
GGGTATGGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAG
GGAGTGCAAGGCCGGTCAACAGGTCTGTGCTGGCTGCCTTGTGGTGGCCTGCATGGCCTC
ACTCTCTAGAGCCCTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGCATGGTTCTCAAT
GGGGGTGATTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCAGTGTCCTGTATCT
CCAGGGGCTACGAGGAGCAGGGGGAAGTTGGCGAAGGCTCCAGGGGTCAGAACCATGGCC
CTGAGTCTCAGGCCTTAAGCGTACCTTCATGAGGTAGAGGGAGTCCAGCGGTGTGGGGTA
TTTCCGAGCATGCAGCTTGGGGACAGAGCAAGAGTTAGACAGCTGGACTGGGTCCTGGGA
TCGGGGGTGTGGCCCTAGTCCTGACTAGTGCTCAGGCAGCCGATGGGAGAGGGAGGCTGG
GCCTGGGATGGGCATGGTCCTGGGCCAGGGCCTGTGCCAGGGCCCAGGTCATGCTTGGTC
CCCTGATTTGGGGGCAGCCTGAGTTGCAGGCCCCATTTGTGCCTGCCGTGCCCAAGCAGG
AAGGCTGGTCTGGTGTGGAGGTCGCACAGTGGTGATGGGGAGGCCCTTGCATGGGGTATT
TGGGCCCCTGGAGGGCCAGGAGGTCACCTGGGCCTTGATGACTTGCAGACCCAGCCTCTT
GTCTCAGTCCCTTTCGTGGCTTGTGTGTGTTTAGGAAGGAGTCTTTTGGAAGGCCTTATG
TGCAGTCCAGAACAGCCAGGGTGCCTGTGAAGCCTCCTGGGATCCCTGTGGTTCTAGTGT
GTAAGTCAGCCTAGCTGGCTGCACTGCTCCCCGTGGAGGCTGTCAGGCTGTCAGGTGTGC
AGGCAGAGGGTGTGAGCTAGGCTAGGCCAGGCTTGGAGGGGTGTGCTTGGAGGCTTTTGG
ACAGTCATCCGGCCTTTGCTTCCTGCAGAGGGCAGTGTTGTGCGCCCTGAGGAGGGTGTG
AGGGCATGCGGGTGTGAGGGCCCCAGGTCTGTGTGGCTTAGACCCAAGGCTTGCAGACTG
TTTGTGAAGGTAGCAGAGAGCTGGTCCAGGGCAGAAGCCAGGGGGCCCAAGAGGGTGCCC
CGCCAGCAGCATCCCTGCATTCCCTCTTGCATGTACGCACTCATACACACCAGGCACCCT
CACCAGTCCAAGCCGGCAGCCACTTTGGCAGGCAAGCAGGCAGGCAGGCTGGCAGGCAGC
CATTGGCGCCGGCAGGCACCTAGGCCTGTGGGCAGTGGTCAGGGCTAACAGCGCAGAGGC
CAGCCTCAGTAGGAGGCAGGCCAGCTGGGTCTTGCCGAGCATGGGCCCAGAGCCCAGCAT
GCACCCTGCTGACGCACAGACGTGTTGTCTCCCCACCTCTCAGGTGCATTTGGCTGCCAA
GCGGACTGGACGACCCAGTCGGTGAGGCCAGGCGAGGAGAGGTCCCGGACCCACTTGGCG
AGCCAGCCCAGGAGGCTGTGGCAGAGGCTGGCTGTGGCGGCTGTGTGCGCAGCCTGGCCG
AGGACACCTCCCCCAGGTAAGCTGGCCTTTGGCCCTGGGCAGCTGGGGCCTTGTTGGGGA
CTGGCACTAGGCCTGGCAATGGGTCGGCCTGCAGGGGAGGCTGCTGCTGATGCTGTTGTA
GCGCTGGCGCACAAGGCAGTGGCCGTGGTGGCGGGCTGCAGTGTGCTCCCACGGGGACCC
ACTCTCCCTGGACTGAGCTCAGGGGCTGGGCTCCTCAGGCCCTGTGGGTGCTGCAGGGAG
GGGCTGAGCCTCTCAGCCTTTCCCTGAGCCGTGGCCGGATCTGGAGCCGAAGGCGAAGGT
GAAGCCGCAGCCAGAGACAGAGCCATAGACAGAGCCTGAGCCGGGCCCGCCTTCTGCCCT
TTGGCAGCCTCCCCGAAGGTGCTGGGATCGATGATGACTCCCCACTCACACCAGCATTCC
TTGGAAAAGCTGAACAAAATGAGTGAGAACCCCCTCCGTCTATCTCATCGGTTCTGAGGT
CCATGCGGCACATGGTGCGACCCTGAGGCAGCAGGAGTGAGGGACACATGCCTTGCCGGG
TCTTGCCTGGCCTGCCCTGGCCTGGCCTGGCCTAGCCTGGCCTGGCCTGGCCTTGCCTTG
CCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTGCCTTG
CCTCTCATCGCCTAGCCCTGCATAGCCTTACCGAGTTTACCAGGCCTCACCTAACCTGTC
TTGGCCTAACCTCCTGGCATCACACTCCCACTCCCACTCCCACTCGCACTCACAGTCCGT
CAAGCAGCCATGTCAGGCAGTGTGGCCCAAAGCAAGGTGGGCCTGTTGGAGCTAGGGTAT
GGCCTAGGGTGTCCCCTGGCAGTACTGGCAGCCAGGGTGGTAAGGGTCAGTCAGGGAGTG
CAAGGCCGGTCAACAGGTCTGTGCTGGCCGCCTTGTGGTGGCCTGCATGGCCTCACTCTC
TAGAGCCTTCTGGTTTGTAGGCCTGGGGCCGGGCAAATGGGCATGGTTCTCAATGGGGGT
GATTGTGGCTTGAGCAGCCTGCAGGGTCTCCACCCTTGCCATTGTCCTGTATCTCCAGGG
GCTACGAGGAGCAGGGGGAAGTTGGCGAAGGCTCCAGGGGTCAGAACCATGGCCCTGAGT
CTCAGGCCTTAAGCGTACCTTCATGAGGCAGAGGGAGTCCAGCGGTGTGGGGTGTTTCCG
AGCATGCAGCTTGGGGACAGAGCAAGAGTTAGACAGCTGGACTGGGTCCTGGGATCGGGG
GTTGTGCCCCTAGTCCTGACTAGTGCTCAGGCAGCCTATGGGAGAGGGAGGCTGGGCCTG
GGCATGGGCATGGTCCTGGGCCAGGGCCTGTGACAGGGCCCAGGTCACGCTTGGTCCCCT
GATTTGGGGGCAGCCTGAGTTGCAGCCCCCATTTGTGCCTGCCGTGCCCAAGCAGGAAGG
CTGGTCTGGTGTGGAGGTCGCACAGTGGTGATGGGGAGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved