Erinaceus_europaeus Locus Mono:294:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:294:SNORA70
Erinaceus_europaeus
Mono:294:SNORA70
scaffold_88453
SNORA70
1001..1135
1343
AATGGCAACAAAAGGGAAAATAAATAAATAAATATAAAAAAAATTAAAAAGAAATAAAG
CATATCATTAAATCAAATGAAGAAGAATGAGGTGTTTCAGAATAAGTTATAGAGGGAGGG
GAATGGTAGGTAAAGAAGAACATGCTGGGGACCTATTACATAATGACATTATATGCTTAT
GAAATTGATTTTACTGTAAAGCATTAACTTCCTCAATAAAAAATAGGTGATAAGTTTCTA
TTGAATTCAAAAGCTGCTACCTGCATAAGGTTGTTCAAAGAATGATTCTATTGAAGTCTT
TTTTATTTAAATCACATTAATGGAGGAAATGAAGATTTAAAGAGTGTTGTCACATGTGCA
GTTTCTTGTATCACCATGATAGGTTCTTCTTTACCACACCTTATAATCCAGATCATGCAA
ATGAACATCATCAATAAAGGAGACACAGATGTTACAGCCAGATGGTCAATAACTTGGAAG
TTGTTAACTTGTACTCAGGTAGTTGTATTTCTCTAAAAGTATACTGTAATCCATACCTAT
TCTGTTTTACTCAGTAATGAGTGTGCCATTAAAGACTTTATGTGGTTACTTTCATTAAGT
GTGTACTTTAATGAAAAAAACATAAAATGATACATTAGATTTCAGTTGTTTTGGTGCAAT
TAAAATAACTTAATTTAGACTTTCAAATCCGAAACCCTATAATTTATCATGAAAAATAAA
GTTAATAATGAAATAGGGGCTGTGGTCCGGGAAGTGGCACAGTGATGAAGCTTTGGACTC
TGAAGCATGAGGTCCCGAGTTCAATCCCCGGTAGGACATATGCCTAAGTGATGTCTGGTT
ATTTCTCTCTCCTCCTATCTTTCTCATAAATAAATAAATTAATTAATCAATTAATTAAAA
AAAAAAGAAAGAAATAGGGGCTGAAGATGATTCAGTAGGATGCATGTCCCATCATCAGTG
TAGCACAGGCTTGGGTCGACCACTACGTAGGAGTTATCAGGATGCTGCCAATTAATCTGA
CCATGCTGCCTTCCCTATGGTGCCCCATGTGTAATGGCTGCCAACAGCAGCATCCTGGGT
GGTGTATGCAACCTGTTGCTTATACAGGGCTGCCCTAAGGGACCCTGGAGACAGCCCTTC
TTGCTAAAAACAAACAAACAAAAAACAGGGGGAAATACAGTATTGGCATATTCTCATGAG
ACTTCAGATCATGAAAATAATGTATATTGAGGGGGATAGTGCTTTAGACTACAGTCATTG
ACATATGATACATTTCATTATGACAGGATCCCACAATAGATTTTATGAATAGTTCAGCCA
AGCCATTAAATACATTAACTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved