Erinaceus_europaeus Locus Mono:468:SNORD32
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:468:SNORD32
Erinaceus_europaeus
Mono:468:SNORD32
GeneScaffold_7093
SNORD32
1001..1082
2082
AGTTCGAGAGTTTCAGGGTTACAGAGTAACAGAGAGTGCCAGAGAGACAGAGTTCCAGA
GTTCCTGAGTTCCTGAGTCCGAGAGTTGGAGAGTTCCTCAGTACAAGAGTTCGAGAGTTT
GAGAGTTACAGAGTAAGAGAGACTTCCACAGTGGAAGAGTTTCAGAGGGTTCCAGAGTTC
CAGAGTTGCTGAGTTCCAGAGAAAAAGAGAGAGTGCTTGCGCCGCCGCAAAGAGACAGCA
GAGTTTTGTTTGGTGATTAGTTTGTGTTAGTTTATGAATCGTTGTTCCTGAATAAAGAAA
TACAGCTTCCCTGCCCAGCCGTGTGTCCGCGAGTCTCTGTTCACCACTGCGAAGCTAACC
CGCCCGGCTAGAGCTTCCGAAATTTTAACAACAGGGAGGCAGTGGCGCACTGGGTTAACC
ACACATAGTACCAATACAAGGACATGAGCAAGAATCCCAGAAAAAAAAACCCCAGCTCCC
CACCTGCAGAAGGGTCACTTCACAAGTGGTGAAGCAAGTCTGCAGGTGTCTACCTTTCTC
TCTCTCTCTCTCTCCCTCTCTCCTCTCTATCTTTCCCTCCCTTCTGAATTTCTCTCTGTT
CTATCCAAAAAATAGGGAGAAAAAAAAAAGTCACAAGAGCAATGGCTTCGTAGTGCAGGT
ACCAAGTCCCAGCAACAACCCTGGAGGCAAAAAGAAATGGAGGCTAAAGGCTTCCATGTG
TGTCAGAGACATCAACATTCTCCAAGAATAGAAACTCTGAAATTATCTTTACGTTTTTCT
TCTCCCTTGCCGCCATGTCCTGAAAGATCATACTTCCAAACCTTTCAGTCCTCTCCCTCT
TCCTTATTCCTCAGCTACCATGCTCAACCAGCTGTTCATTATTAAAATAACTTAGCTCCA
CCTGCATATCAGATGTCAGGCTCAGGAAAAAAAAAAAAACTAGTATAGTCATGGGCTCTT
TGGAATACAGCTAAAACAGGACTACTAGGTACAAAGCAGAGAGGTCGGTGATGAGCAACA
ATCACCATCTTTTGTTTGAGCCTCACGGCCATGAGATCAACTCCATGCACTGCTCTGAGA
CCTCCAGGAAAAAAAAAATAGAGATGCCCCAACTCTTCATATGAACTTTTCCAGCCTTTA
GGTTCATGATGACTCAACAATTTATTTGGCTCTATATGTTAGCTCTTTTTTCAGTCACCA
GGTTCCACATGCAAACATGATACCAACTGGACTTCCCTAGGTAGATGACCACACCAATGT
GTCCTGGAGCCCTGCTCCCCAGAGCCCTGCCCCACTATGGAAAGAGAGAGACAGACTGGG
AGTATAGATTGAACTGCCAACGCCCATGTTCAGTGAGGAAGCAATTACAGAAGCCAGACC
TTCCACCTTCTGCATCCCATAATGACCCTGGGTCCATAATCCCAGAGAGTGAAAGAACAG
GAAAGCTATCAGGGGAGAGGATGGGATATGGAGTTCTGGTGGTAGGAATTGTGTGGAGTT
GTATTCCTTTTATCCTATGTTTTGTTTTGTTTTTTGTCAGTGTTTCCTTTTTATAAATAA
AAATTAAAAAATAAAATGAAATAAAAGACATTACCAAGTACCTATATGTACCAAGCAGAG
GAAATACACTGGACAAGACAGAGTCCCAGACCCAAGCAGACTTAAGATGGAAGAACATTC
CATACAGTGAAAACAATAGAAGCATGTCACTCAGAGACAATAAATACTACTTGGGCATAT
GACAAGTAAGGCTCTATAGGAAAATATAAATAAAAAGCAACTTTGGTTATCATTATCATC
ATAGAAGACAGTGCTTATTCAATGCTGAACACAGATACTTTATAGCCACTGACTGATTTA
ATCCTCAAAACAACCAGTATAGGCCCAATTATTGTTCAGATTTTACAGATAAGGAAGCTC
ATGCAAGAAAGAGTAAGTCACTTGTCCAAGATGTGAATCCAAGCAGTCTGACTCCAGAAT
CTGTGCTATTATGCCACCTCTCTATCATGGGCCCCTTGGAACATATCTAAAATAGATTTC
CTAGCTATTTCCCACACGAAGACCCCTAGTTTCATCTGCTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved