Erinaceus_europaeus Locus Mono:38:SNORA70
snOPY snoRNA Orthological Gene Database
Erinaceus_europaeus Mono:38:SNORA70
Erinaceus_europaeus
Mono:38:SNORA70
scaffold_367869
SNORA70
1001..1138
2044
CCTCTCCACTATTATTGTTGTAGTTGTATTGTTGTCTGTCTTCGTTGTGTGGATAGGAC
AGAGAGAAATGGAGAAAGGAGGGGGAAGACAGAGAGGGAGAGAGAAAGACACCTGCAGAC
CCGCTTTACCGCTTGTGCAGCGACTCTTCTGCAGGTGGGGAGCCAAGGGCTCGAACCCAG
ATCCTTACATCGGTCCTTGCGCTTTGCGCCACGTGTGCTTAACCCGCTGTACTACCGCCC
CAACTCCCCGGAAATACTCTTTTAAAATATATATATATATATTATTTACTTTGAATAGAA
GCAGAGAGAAATTGAAAGGGAAGGCAGAGGTAGAGAAGAAGAGAGAAAGAGGCTTGTAGC
ACAGTTTCACCACTTGTGAAGCTTCCCTCCTGCAGGTGGGGACCAGCAACTTGAACCTCG
ATCCTTATGCACTGTAATGTGTGTGCTCAACCAGGTACACCACCATCTAACACCTAATGT
ACGTATATTTTTAGTATTTTATTTAGAAAACACTATATCCCACTGAGAGCTAATTGGCAT
ATAACACTGTGTAAGTTTAAGATGTACAGTGTATCATTCAGTACTATTATGTGTTATAAT
GATTACCAGTATAGCTTAGCCAGCACCTCTGTTGGCTCACATAATTATTATTTCTTTTAT
TGTGATGAGAACATTAGTCTGTTAGCAACCTTGTAAAAATCACTCATATATCTACTACTC
TTTCCAACTCTACTACCTACTCCCAGAAAGTTTTTAAACATTGGGTGAATTCCTTCTGTT
TGACAGTCTTACAATATCACTGATGTCCTTTTTCACCTCTAATATACTTATTAACTCAGA
AAACATTTGTTATCATGCTCTACCAAGTGCCAAGCAAAGACTCTTAGGAAATAATATATG
ATTCTCCCTGCAGTCAATTGAGCTGACTGTGTTCTCCTCCTTCCCCATGGGCCCAGTCTG
CCATGGCTACAAACAGCAGCCTCCTGGGTGGTGTCTTCTGCCTGTTCCTTGTACAGGTTG
CCCTAAGGGACCTTGGGGGAGAGGCCTTCCTGCTGACTATTCACTTTATTTTATTTAATT
ACTGTTTTATTTATTTGTTTGTTTTTGCCTCTAGTGGCTGGGGCTCAGTGTATGAATCCA
CTGCTCCTTGTGGCCACCCCCTCTTTTTCCCCCCTCCATTTTTATTAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved