Equus_caballus Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Equus_caballus EEF1B2
Equus_caballus
EEF1B2
18
SNORD51, SNORA41
1250..1328, 1614..1745
3301
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCCGAGATCGGAAAGTCGCGTGCCCTCCTTTTCCCGCC
GGGACTGGGGCCGCCTGCTGTCGCGGAAATCTTTCTCGGAAATATTGGCGCTGTGCGGCC
TTCCCCAGGGGCCGGGGGGGCTGATTGTTGGCGCTGGACAACGTTCTGGCAGGTCTCTTG
CTGGCAGAACGTGAGGTTTCTCCGGTAGCATTAGCGGCACTTGCCGAAGGGGGACATGGC
TTCTCCCGTCTCTGCATAACCGTTTGGCCAGACCGTGGTAGTTGTCGGTCAGATCCTCAG
CGACCCTTTCTGTGCCTGGTTCCCTGGTCACAAGGCTGGCCTTTTCCGCGACTAACGGGA
CCCGGCTCACCTTATTTCCTGGGGAAGTTATCACTGAGCGTCTGTGGCTTGAGAAGGCCG
GGAGGCTGCAGCCCTCCGTCTTCTCGCGGAGCAGGTGGAACGTGGACAGCAGCAGCTCAG
CGGGCCCGCCCCGCCGCTGATCCTGACCTGAGGGCCCGCCGCTGCGGGGAGGGGGCTGCT
CCTTCAGCCCTTGGCCCTTCCTCTGAAGCTGCCAGTGCGGCTGCAGGTGTGGGGAAGGGG
GCTCCGGTTCACTCGGGAAGGAACTGAGCGTGCCTAAGCTGTCCCACGAGTCTCCGCTCT
GAAAGAACAATCGTGGCGTCCTCCTTGCTCCTAATGTTTGCCGGGGGAGGAGTTAAAGCA
CGTGAAACTGCCCCCCTGCGAGTTTTGAAGGGTAGGTATGCTCTTAGTCCAAAAGGGGTC
TGTGGATAAGTGGTTTAGTAGTCGTTGAATTTACGTTTTTTTCAAGTCTGCCAGGAGTGA
AGAAAGCTTTGGGCAAGTATGGTCCTGCGGATGTGGAAGACACCACAGGAAGTGGAGCTA
CCGATAGTAAAGACGACGATGACATAGATCTCTTTGGGTCTGATGACGAGGAGGTAGGCA
AAATCGATGGGCTGTGTGTGGATCATTGTGCTTAAGCGCAGGCTCTGTGGCCACATTGCT
TGGGTTTGAATCCTGGCCTCACTTTATTACTTGCCTTTTAAGAATTGTCACCTGTTACAT
GATGAATAAAATCAAATCACCATCTTTCGGCTGAGCTCCTGATGGATTTGCTTTTTTCTG
ATACAGTTGGTCTTCGTTGTAGACCCCACCAGCTTTAAGCTGAGGAACAGCCAGCTTTGT
GAAATGTATCAATTTTTTCTTTGCAGGAAAGTGAAGAAGCGAAGAGGCTAAGAGAAGAAC
GCCTTGCACAGTATGAGTCAAAGAAAGCCAAGAGTAGGTCCTTTGATAATTTGAGTTGAT
CCTTTCACAGTAATCTGAGTGATCTTTGTCAAAGGTTGATCCCCGGAGTAATGTCCTCCA
TGTTGGTGGAGCAGGTCGGTGTTTGAAGCCCCCTGTAGGGGTGGCTCCCACTGTCCCCAC
AGCTCCTGGGCCGCAGCTGTTCTCACGGCAGCAGCTGTGGCATTCCTCTGTGGGAGAGAA
ACTGTTACACGATTGAAACCGCTTTCTTAGCAAAACAGAAAGCGGGCATGTGTGTGACAA
ACACAGGATGTGTGAGTTTGGTGTGGCTGAGGAGATGATGCGTTTGAAACAGATTTTGTT
AAGTTTCTTGGACTAGGGTAAAAAAATATAATTCAGCATTTGAATAATGTTTCTTGTACT
TTTTTGTTAGAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGG
GATGACGAGACAGATATGGCAAAGCTGGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGC
TTGGTCTGGGGCTCCTGTGAGTTTACTCTTTGCTTTTTTGAAACTGACGTCTGGAATTCA
CATATAGTTTCAACCTTGACTAATCAGGACGGTTCTAACTAAGATTTTTCTTAATGCTCT
TTTCAGCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAAATACAGTGTGTAG
TTGAAGACGATAAAGTTGGAACTGATATGCTGGAGGAGCGGATCACTGCTTTTGAGGACT
ATGTGCAGTCCATGGATGTGGCCGCTTTCAACAAGATCTAAAACCCGTCGTGGATCGTTG
CTCTTAAATAAAAGCTTGAAAGACAATTCTTTGTACATAGGAGGGTGTTATTTATATTCT
TTCTGTTTTGCGGCAGGAAATTCAGTGGATGGGTAATTCATAAAGCATTCTCGTTAGACA
TTTAGCCCAAAAAGGAGAAAACTATTACCAATACCTTAAATATACATAGGTATCGATTGG
ATTGTATAAACAAATTGATAGCAGTGGACTCACTTTTAGTATAATTTCTGTACCCATTAG
TGATGTCCTCGGTAAACATGATGGTACTGCTTTTACCACAATATTTCAAATTTCCATCTT
TGCCTCGTTTTTAAAAGAAATCAGGGAGATTAACTTCACTTGTGGACTTTTTAAAGATTG
GTTCCTGAGCTAACAATGTTGCCAGGCTCAAGCTTTGCTTTTTTTTTGCTTTTTCTCCCC
AACTCCCCCCAGTACATAGTTGTATATTCTAGTTGTGCTATGTGGGACACCGGCTTAAAA
CAGCCTAATGAGCGGTGCCATGTCTGTGCCCAGGATCTGAACCAGTGAAACCCCAGGCCG
CCAAAGTGGAGCACACAAACTTAACCACTCGGCCACCCGGCTGGCCCCTGGGCATTGTAT
GGAGTTTTGATTTTAGGTGATTGGGCCTGTGGGTTTATAATGGTTCTGACCTTGGCCTTT
GCAAGGGGTTTCAAAGTTATATGCTATCTCAGCTGGTTCTCCTCAATGGGAATGTTGGGA
ATAAAAGAATCGTGAGAAATGAGTCAATACAGTTAAAGTGCTTAGGACAATACCAGGCAC
GTAGTGAATATTGTCGCTTATTTGCCAGATAGCTAATAAAACATTTGTAGATAAAGGGAT
TAAATGCCAGGATTAAGACCATTCAGTGACTTAAATGGCTAGTGAAGTAATTTGTTGTAA
CCTAGCATTTTCAAGTTGGGGGGTTACTTGTGACTAAAAAATCGCACAGCTATAAATCCC
ACCTGAAAATAACGTGTTACGAGATGGGCTGTGCAGCATTAGTAAAGAACCCTAACCTCG
AG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 1406..1472, 1870..1995, 2106..2301
1001..1132, 1406..1472, 1870..1995, 2106..2257
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved