Equus_caballus Locus ENSECAG00000024696
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000024696
Equus_caballus
ENSECAG00000024696
18
SNORD70, SNORD70
3564..3652, 4341..4425
24712
CCCGTTCCCATCTTCCTCTACTTTATACGTGGGACGCCTACCACAGCACAGCTTGCCAA
GCGGTGACGTGTCCGCACCCAGGATCCGAACTGGCGAACCCTGGGCCACCGAAGCAGAAC
GTGCACACTTAACCACTGCACCACTGGGCCAGCCCCAGGAAATAAGAACTTTTATTCACT
CTTGATTTCAGTGAAACTCATAAAATCTCTTAAAGGCATTTTGGTAACATCTGTAAACGT
AAAATAATGCATTTCCATATGATCTGTTAACTCCGCTTCCAGTAGTTTGTCCAATAGAAA
TATAACTTGTAAAGCTCCAAAAATGTTTTCTGAAGGATAATAAGAAAAATTTAGAAATAA
CATAAATATTTATCAATGAGGGCATAAATGGTGGTATGTTCATACAATACAGTTCTAGGT
TGTTAAAACCCAGGATTATATCCATGGTATGTTAAATGATTCCTAAAAGTCTGCCTAAAT
AAAATGTCGCATAGACAGTGAAAAAGTCTTGAAGAATAAACTAAATGTTAATGATTGTGC
TTCCTAGATTAAAAGTGCACCTTTTTTCCCTTTGAATTTTAAAATTTCTTACATCAGGAT
GTGCCTTGCAATTGATGGTATCTTAGTTTTAGAGAAATCCGTAATACTCTTAGGTTAGGA
TGATCTTAGCAGGAAATAACAAAATTTATTCTATACAAAGGACGTAAGTAGAGCCTTGAT
GTTTTGCTTTGAGAAGCGTGATGACCTGCTTTGTGAGGTAGGGACTCCTTCAAAGTAAAC
GGTTCTCAACAAAGGCCCCAGCGAGACCTGAATCCCATCTACTTATTACATGGGCTACTT
GAGCGATTAATTTGACCCAAAAATTATGCTGAGTAAGAAAACTGGTTTATTTCAGAGAAG
AAAATAGCTTCCACCACCCTCATTTTGCTTGTACAGTTGTACTTGAAAAGCATAATTATG
TATGCCTAAGTGGTGCAATTTAAAGAAAATTATTTAAATGTTTATTACAGGTTTTGAATG
AGAAGAAACTTCAAGAGGTTGATAGTTTGTGGAAAGAATTTGAAACTCCGGAGAAAGCAA
ATAAAATGTAAGTCATCTTGAAACTAAGAATTTAGCAGTTAACATTCAGGGTGTTTTTGT
TTTTACGTTTTTTCCCCTCCTGACTCATATAATGTTATATTCATAACTTTTTGTTTTGAA
ATCTATATCAGGAATAATATTGGTAATGGCCTAATTATTACATTCTTTATTTGGAGCATA
GGCCATCTCAACTAATTTGTATTAGTTGCAGACTAGTTGAGATAGTACCCCAAAATTACT
ATTTTGTAAGATACTTGAAGTAAATTTCTGTTAAAAGTAATAATTATCAAAAGAATGCGT
TGCTGATTGATTTAACTTTTAGTTTCTGTGAGTTTGTGGTATTGAAATATTTTTTGTTTT
TTGAGGAAGATTAGCCCTGAGCTAACATCCATGCTTATCTTACTCTGCTTTATATGTGGG
ATGCCCGCCACAGCATGGGTTGACAGGTGGTGCCTAGGTCCACACCTGCATCCGAACAGG
TGAACCCCGGGCCACTGAAGCGGTACATGCGAACTTAACCACTGTGCCAGCAGGCTGGCC
CCTGTGGTATTCAAATGTTTTTGAACTTAATTCATAGTTTATTTATTCTTTATGACTTCT
ATGTCCTAGCTCCATCTGGAATAATAAAATAACTAGATAGTAAATCCTGGAAAGGTATAC
TTGAGTTCATCACGATCTCTGAACGAGAAAATAAAGCATGCTTTTTTTTTTTTTTAAAGA
TTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCAGTACATAGTTGTATATTCTTCATTG
TGGGTCCTTCTAGTTGTGGCATGCGGGACGCTGCCTCAGCATGGTTTGATGAGCAGTGCC
ATGTCCGCGCCCAGGATTCGAACCAACGAAACACTGGGCCGCCTGCAGCAGAGCGAGCGA
ACTTAACCACTCGGCCATGGGGCCAGCCCCCCCCCTTTTTTTTTTTTAATATCTTTTTTT
TCCCCTGCTTTTTCTCCCCAAATCCCCCCAGTACATAGTGGTATATCTTAGTTGTGGTGT
GTGGGACGCTGCCTCAACGTGGCCTGACAAGTGGTGTCATGTCCACGCCCAGGATCCGAA
CCAGCGAAACCCTGGGCTGCCGAAGCAGAACGCATGAACTTAACCACTCAGCCACGCGGC
CGGCCCCTAACGTATACCTTTTTTTTTTTTTAAGATTTTATTTTTCCTTCTTCTCCCGAA
GCCCCCCGGTACATAGTTGTGTATGTATTTTTTTAGTTGTGGGTCATTCTGATTGTGGCA
TGTGGGTTGCCACCCCAGCACGGCCTGATGAGTAGTGCCATGTCCGCACCCAGGATTTGA
ATTGGCGAAACCCTGGACCACCAAAGCAGAGCGCGCAAACTTAACCACTCGGCCACGGGG
CAGCCCCTGAAGTATACCTTTGATGTCTTGCTTAAGGAATACCTGGTAGGAGAGAGAGTT
GGCTTTTCCTTAAGGTCGAGTCAAAATGGCTGTTTTTACCTTCTGTGAATCACCTTGTGA
AATAGCCCATTTGATGAGTGTGGTCCTAGGAAAGGACCTGACTTATCTCTTCTTCTTCTT
TTTCGTCTTCTTTTCTTTTTTTTTTTTTGCTGGGAAAGATTCCCTCTGAGCTATCACCTA
TTGCCAATTTTCCCCTCTCTCTCTCTCTTTTTTCCCCCTCCCCAAAGCCCCAGTACATAG
TTATATTTTCTGGTTGTAAGTCCTTCTGGTTCTTCTATGTGAGCAGCCACCACAGCATGG
CTGCTGACAGACAAGTGGTATAGTTCCATGCCTGAGAACCAAACCCATGCTGCCAAAGTG
GAGCATGCTGAGCTTTAACTACTGGGACATCAGGGCTGGCTCCTGATTTATTTCTTAATA
CATGTGGATTTGAATGGTGTCCTTGGATGCCAAAGGGCATTTGATATTTCATCTGCTAGT
GCTAAAAAAAACTCATAAGAATAGAAGGAAACTACTTCCAAGCTTCTAAAGAGTGTTGAA
CCCAAAAAAATGTCATAGATACTAAACAGTTAGAGAAAATACAGAGTTTCAGCATTTGTA
GTGGCACAGACCCAAAATTTGAAACAACTTAAATGTCCATCAGTAGTGGAATTGTTGAAT
AAGTTGTAATATACCTATAGATCTCTTGTTGACCTGGAGAGGGGTCCATGATATACCGAG
AAAACCGTGCTTCAGGTAATTTGTATAATGTGATCCCATTTTGCAGTGTTTTTATAGATC
TATACGTGTATTTATGTAAGTATAGAAAGGTACGAACAAATGCCACTTCAGACGAATGGA
AATGGGGGTGAGGTAAGATGCAATAAGATGAAATTACTCTTTTTTCCTTAAATCTTTGTA
TTAATTGCATATTTAAGGGACCCCCCAGGGTGTTCTCTGATCAGGTAAGAAAACCTTGCT
TAAGATAACACTATTTTAGACACGACAGAAAATTAGTTCTCCCTTTTAAGAGGCTTTGTG
CTTCAGTTGGCTGAGTTAACCTGATTCATTGTTGTCAATGATGTATTCTTGTTGGAACTG
AATCTAAGTGATCTAACTCAAATATTCGTCACTACCACTGAGACAACGATGAATTAACTG
TATCTATCTGTTTGAGACAGAATGATGTAACCCTGCACGTAGTGTTGGGGTGGGGGAGTA
AAGGAAGGGTGACGGGAATCAGGTCTGACAATAAGCTGTTTTTATGGCATTTGTACTGGA
TGGACAAATCAATGTCATGAGATTCCTGACTGAAGAGGGACCCTTATACCTTTTCTTAGG
CCTCTTCTATGCTGTATAGTAAAAGGCATCTGTGTCCACTTTTAAGCAGCAGAGCTTATA
TGGAAGCTTCAGCGTCTTCCTTGTGGTTTACATGTGGTAGCAGACCTCTTTGCTGTTCTG
TTTCCTTCAAAGCCTGTAACCTGTGTAATAGTCCAGGCATTACTAGCCTAGCATTTGGAG
AAACTGGTCACTTTATGAAGAATGTCTAACTTTGCACCCTGGTACCCAATGACAGGAGAG
TTTCTTTTATTGGAGTATGATTTGGAAACAGTCCAGCACCTCTTTCCTAAATATGTGGCT
TTTCAGAATCACTGTGCCCCCATAACATGTTTTTTGTTTTGTTTTGTTTTTTCCCTCTAG
AGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCATTAGCAGGTAAAGT
CAAAGACTAGCCTTTTGTTTTTAATTTTGGCAATTTGTTGTCCTTATTAAAAGATTGCTT
CAGTTTCCTGAGTTAACCTTATTCAATGTTGTCAATGATGCATTCTTTTTGGAACTGATT
TTAAGTGATCTAAGTCATTCGTCACTACCACTGAGACAACATTGAGTTAGCTTTTTTCAC
CATAGGGCTGATTTTTCCCCCCATGTGATGAGAGGTGAGAAGTGGTTAAGTTGATCTCCC
TGTGGAAACCAACAGCATAATGCTGAAGCACAATTCAGTAAAAGCTGTTCTACAAGGGAC
CAAGGTAATGTGGTCAAGTACACAGCGCTCTAATCATTTTAATCCAAGAGTAAAGTTGAG
AATAGCCAGGATTCACAGTTGAAAGAATAAGAAAGCAGCTCTCCGGGGTACGTTTTTAGT
TTGAAAAAGCACAATGTTAATGAAAAGTTTTAGGAGAACTCGTAGAGGTTTTTTGGTGTG
TGTGTGTTCTAATAAGAAACCTATAGAGAGGCGTAAGACTTGTTTATCTAAAGGGGGCAT
GATGTTTAGCACTTGAGAAGAATGAATGGCTCATATATCCTTCCACTAGTCCTTGTGATG
GGACAACAGACATAGTAATAGGGTTTATTAACTAGGCTTGGCTTCTGTAGGCACTTGGTC
TTATAAGGTTTTTTTAATGTTAGGGAAAACAAGAAAACCAGATGTAAAACTCTAATCATG
AATTTTTCAATTGCTTAAATTCTGTATTTCAAATCAGCCAACTACTCGGCTTAAATAATT
TGAAAATGAAGGACCATGAGGACGAATATGGCTTAAAATTAGGCAAGGATTTGACAGACC
CAAATAATTTTGTTCATCAGCCACAGGAGAAGGGTATAGTTGTCTTGTGAAAATTAGGAA
TCTAACTAAATATGCTGGAATAGGGGTCGGCCCAGGGGCGTAGTGGTTAAGTTCACATGC
TCCACTTTGAGTGGGCTGGGGTTTGCAGATTCGATCCCAGGCGTGGACCTACACACTGCT
CATCAACCCATGCTGTGGTGGCATCCCACATAGAAAGAAGAGGAAGATTGGCACCGATAT
AAGCTCAGCAACAGTCTTCCTCATGAATAAATAAATATGCTGGAATATTATTGAGCCACT
TCAACCTTGGCAGAAGGGTAAACAGAGGGAAGACCCAACAGTGGGGCTAGATTTTTAATT
TTAAAGATAGTTTTAAGGCTGCTTCATCAATACATCAGTAATTAGAACCTAATAGAGCAA
TAAAGCAACTATGGTAGTTTTTGCCTGGAGATTTTTTTTAAGATAATTCTGTTCATCACA
GCTTTAAAATTAAATGTGGGTAGAATTTTGGCAAAATCCCAAGCAAGATTGTGTTAGCTA
TTCTCCACCTTGCCGGGGGGCGTCACTCACGCAGACTGATTTGAACAGCTCCTCCCGCAG
TTGTAAAGTGCTGCATCCCCAATCCCGAGTGGCCTCTTGAATTCCTTTTTGCATATAACC
TCTAATCTTGTGGGGGTGTTTCTGACCAGTCCTCATTAAACTATTAAATAGGCAGATCCA
ACCTCTACCCAAACATAAAACAGGTTTTTACTCTTGATAGCTAATAATTCGTTACATGAG
ATTGTCAGATTTTGCACTCATCACTTCAAAATTATTTAATCCTTGAAACAATCCTATAAG
GTAGATAATATTATCATTATTTTACAGATGATGAACTGAAGCTTGAGAGGCATCTCATTT
CCCTAGTCAGCTTTTGGTGTTCTTTAAAATAATCTAAGATAAGTGGGGAAAATGCCAGAC
AGGTGAAAATTTAAAGTCAACCCCTGACACACACACCTCCCTCAATATAAGTTCCCTGGG
GGCCGAGACAGTGTTGTTTCACTGTCAAATCCCTAGATTCTGGTGCATAAATATTTGGGG
GTAAATGAATGAAAGTAGTGAGCTCTGTCTGGAATCTGCTCATAGAAACCTCTACAGTGC
CTTTTCCCATCTATTTTTACCGGAAGTTGAACATCACCTTATTGAGAGAGCAGAGTCCTT
CCTGAGAATTAACTTCCTACTCCCTGTTATAAGGCAGTTTTGACGTGACAAAATCAAAAC
TAAATGGTTGTAGATGTCAGAGTATGCATTTAAAACCCTGTAGCCTAAGAAAGAGTCTGA
TGGGGTGCGATGTCAAGGATTTATAGTCATCCCAGAAGTTTAAATATCCCATTTGCATGG
ATAGGTTTATTTTTATTCTTGGTCAGATTTTCAAGTTGCGAGACTTGTAAATAGCCACAG
TAAAATTTGGGGCCAGCCTGTGTTTGGATGAAGTGGGAAGACTGCTAGGGGATGTTGGGC
GTGGCCGGTAGGAAAGAGCAGTAGAGGGAAGACTCAGCTTTCTCTCTCCCGGCCACTGTG
TCTCTACGCAGTCTCGGAAAATGCACATTAGGAAGAGTAATCAGCAAGCTTTTGACAAAG
GGAAGATAAGTGCTTATAAATGTTAGAATAGGTCTAGAGTAGAAATTTTTACTTTCAAGA
AATTTTAAATAAAGGAGAACACTAGGTTAAAGTATAAAAGTAGATATGGAAGGTTGAAAA
CTAGAAGCAGGAAGTTGAATAAAATTTTTTAATTATAAAAGATTAAAAACTTGTAAGCAA
AAAATACAACTCTTATGAGAAAAGTAGATTATAAGGAGTCAGTGTTGTACAATATGTAAA
AGGTTAAAACCCAACAAAAGTAGCTTGAATCTTAGCTTCTTGGAGTGTAGACACCTCTGT
AAGAGCTGTGTAGTCACCAAATAGGTTTTGTCCTTACCTTTCCTCTTCCCAGATGACAGC
TGAAGTGGACTCGTGATCCAGATGGGTGGAGACGTTGGTCAGGAGGGAAGAACAGATCCT
TGGCTGATTAAGCACAGACTACCTGGCCTTAGAAATTGTGCAGACTTCTTTCCTGCCAAA
CATACTTTAAACTCAGCCAAAACCCAGACAAGTATCAGAAGAGGTGTGAGGCCATAGGGG
CCCCGAATATCTAAGTGGAGGTCTAAGGAAGGGTGAGAGTTATAAAGCGGCAGATAGAGA
ACTCGCCAGAAATGAAAGCAGTCCCAAAATCAGGTGGGCTGCCTTCACAAGTAACTTCTC
CATCACTGCAGTTTACAAGCAGAGGCCTGACACCACATCTAGATCAGGGATTAGCAAAGA
AAGATAAGGCCTCCACTCAGACGTGCTTATGCTGCAGAAGAATCTTCAAAATGAATACAC
TCGTTTTTACCAGAGTCTTGACGGATTCTGGGGTATTTCACAATCCAGAGCATCAGGCCA
GTCAGTAATAACATAGGAGAGTGGATCTATTTGTCGTTCCAAAATGGATTGTTTCTAACA
TTTTATGATTCTAGCTCTGAGTTCCAGAGAAGATTCGTGTGACGTGGGGAAAGGAATGCT
GGTTCCAGTTTAATTCCTGATTCTGGAGCAGAACTGAGGGTGGGAAGGTCAGATGAGATG
ATGAAATGTGAACTTGCAAAACATTTTTATCTTTATAATTTCATTTCAGAAGTAATGTTA
AGTGCAGCACTTTGAGAGGAAGTGTTTATTTTGCTTTATTTTTAAAGTTTAAATAAAATC
TTCATCTCTTAGAGTTAAAAATTTGAGAGTTGTCTCTTCTCTTTTTCTTTTTCCTGAAAA
GCGTTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAGAAGGTTCTGAAGAAA
ATAGTAAAAGAAGCCCATGAACCCCTGGCTGTAGCTGATGCTAAACTAGGAGGGGTCATA
AAGGTAAAGTATGGTTTTCTCTCATGCCTGCTAAGCGGAGCTCATTACACACAGTGACGA
CAGAGTGTAGCCTTTGTAGTGAGTTCTTTGTCATAAGGTCTCATACTTGATCTTTTTTCC
CTAGGCTACCTCATAATTGATTTCCAATATGATTATCAGCACTAAGCGTGTATGAGCAGT
GCCTATTCATTATAGAAAATACAAATACACCTCAAAATTATAAAAATTAGCTTTCACCCT
GCTACCCAGAGATAATCTGTTAACACTGTATGTATACCCACCATGTTTTTGTTTACCCAC
TCTTTTTTTCATGATTAGGGTCATGATATTTCTTTTTTAGTGTATATGTTTATTAGAAAA
CTTTAGTAGGGGGTAGAGTTGCTAGAGATTAAATATAACATGAAAGTGGAAAGAAAGCCT
GGAGAAGTAAGCTCCCAGACGTGAAAAGCAGAGCAGTTGGAGAGCCAGTGTGATAGTTTG
ATCTTTAGTAGTTACAGTAGATATTATAGTGCCAGGTTAATTATGTTCATGAACATACCT
CTGATTCTTGAAGTAAAGGTTTCATTATGTTGTAGGTCTTGGTAGGTAGGAAAGTGCTGA
AGAGATTTTGAGGGTTTTTAAAGCTAGGATTGTGAATTTAAGAATTTCACTTAAATAGAT
TATTTCTTTTTTTTAATTATTATTATTATTTTTTAAAGATTTTACTTTTCCTTTTTCTCC
CCAAAGGCCCCCGGTACATGGTTATGTATTTTGAGTTGTGGGTCCTTCTAGTTGTGGCAT
GTGGGACCCTGCCTCAGCATGCCTTGATGAGCGGTGCCGTGTCCGCGCCCAGGATTTGAA
CCTGTGAAACCCTGGGCCGCTGAAGCGGAGTGTGCAATCTTAACCACTCGACCACAGGGC
CGGCCCCTAAATAGATTATTTCTAATTACTGTCAGTTAATGAAGTTTTCTGTCATGATGT
CAATCTCTATCTTCATCCTTTGAAGTCCCCACAAGTCTTAGTTTATACTTTCCTTTTAAA
AACATTAAGTTTTAGCATAGTAAACATATACACAGAAAGGCATGCAGAAGAACAAATTGC
TGAATGGTGGGATTATGGGATATCTTTAATTTTTTCCTTTCAATTTGTCTAGTTGAAAAA
CTTACGCTGGGATCCAGCCCAGTGGCATAACGGTTAAGTTCGTGCACTCTGCTTCAGAGG
GCTGGGGTTTGTGGGTTCAGATCCCAGGTGCAGAACTACACACTGCTCATCGAACCATGC
TGAGGCAGCAGCCCACATATAAGATAGAGGAAGACTGACAAAAATGTTAGCACAGGGCCA
ATCTTCCTCACACACACACACACAAAACCTTCCACTGTATATCACTTGTATACATACTAA
ATATTTGTTTTTTAAACATATGATACAATATATACAGTTTGCACGCTTGACATTATTTGC
ATTTGGTGAACTTAGAACTGTGTATATTTGTGTGAAGGTGTGCAGAACAATTTATCGTGT
TGTGTGGGATGTGTAAATTTTAAGCTGTATTTATCAAGATTTGTGTATGTGTGTACACAT
GTGTATATATTTGGAAGTACATAAGGGATGCTAAAAGTTACTTATCTTTAGGGAAAACGG
TCCAAAGCTCACAACTTGTGCTTCTCATTCGGTTCCCTTGTCTATAGTACTATTGATTAA
AATCTGTCTATGTGTTAATTTTATAATCTTAAAAAGAAGCTAAATAACGTATGGGTGTAA
ATGATCCCTCAAACCAATAAAAAGAACAAAGCTGCTAGGTTAAGTTGTATTCATCTTTTT
ATGGCTTTTGATGCATGGAGCCAAGCACCCTTCCAGGAAGCTTCTATCAATTTTGACTTC
CACAAGTATTCAAGTGTTTTTCCCACAAACACGCTAGAAACTGCTTTTTATGAAACTAAG
AGATGTATATATTTAAATCAGTGCTATTTTAACATTTAAATGATTTCAGGAAAACTTTTA
TTTCTTTATTTAATACCAATGCTCTTGTTCTTGTAGGAAAAGCTAAATCTCAGTTGTATC
CATAGTCCTGTCGTTAATGAACTTATGAGAGGAATCCGTTCACAGATGGATGGATTAATC
CCTGGGGTAGAACCACGCGAAATGGCAGCTATGTGTCTTGGATTGGCACACAGGTGAGAT
TTACTGGAGAATAAAGTCGGCTTATTTTTATTTAATAAACAATTGTACAGTGCTGTTGAA
AGCATGTTACAAATACTAATTTAACCCTCACAGCAACCTTATGAGGGAGGTGGTAGTAGT
CTCCGCATTTTTCAGGTGAAGAAACGGATGCCCAAAGTCAGTACAGCTGGTAAAGATGAA
GCCAGGATTTGAACCCAGGCAGTCTGGCTCCGCTGTCTGGACTCTAACCGTCATCATAGA
CATTGTCCACCCCTCTAGTCTTGGGTCCCACAATTCTTGGGGTTCTTTTTTCTTTTATCT
CTGCTAAATCATTTGCTACTCCTCCATTTACTTGCCCTCTCCCAAAATTTTCTCATATGA
TATAGTCTACCCTTCTGCTGTGTCTGTGTGTGCCTGTGTTGCTTGCTTTACTCTGAATTT
TATTGAGTTTTTATAATAATAAGGCAAAGAGAAGCACATTAACCTATCGTGTTTAACCAG
TGGTCCATTAGAACAGACATTTCTGCTATACCATATTCCTGAAAAGTTTGGCATTCTGTG
AAATTACACTGAAGTAACAAGGTTTATGAAGAAAAAACAGATTAAGGGCAGATTACTCAA
AACTTATGCAACCCTGTAACCAGAGAACTGTCAAACACAATAACCCCCCAAAATATTAAC
ATAGTTAAAAAGACTTGTTAAATTTATGTTACAGAAATACTACAGTAGAAAGGTCTGTAC
TTTTGAACAACAAAAAAACTGAGCGTAGATTGATGAAAGAGTTAAAGCTACTGAGTTATA
GAGATGATCAAAATGCACAAAAGTCAGGAAGAACTTTGGAATCATTTCTAAGAGACAACA
AATGGCTAAACTGAGTCAAGATGCAAACGTGGTTAATTGATGTTGAGCACAGTTGTGGTT
CTCAGTCGAGCGCAATCAGATATTCCTTAGAGGACGTTTGGAAGTCTAGAGACATTTTTG
GTTGTCGCAACTGGAAGTGGGGTCTGCTACTAACATATAATGGGTAGAGGCCAGGGATAT
TGCTAAATATCCTGCAATGCACGAAATACCACCCTACAACAAAGAATTATCAGGCCCACA
ATGTTAATACACTCGTGGGTCACATGATGTTTCAGGCAATGATGGACCTCATATGCGACA
GTGGTTCCATAAGATTAATACCATACAGCCTAGGTGCATAGGAGGCTATCCCATCTAGGT
TTGTGTCAGTAGACTCTCTGATCTTTGCACAAACAATGAAATTGCCTAACGACGTGTTTC
TTAGAATGTATCCCCGTTATTAAGCGATATGTGGCTATAGTGCCAAAATAAAGAAACTGT
TAATATACAATATTGTTCCTCCATGGCTTGCTATTTTCAGGGGTTACATTACTGCACCTT
TTCTTACCTGCTAGTGTAAGGCATTAATATGCTGCAGAAGTCTTATGGACCAGTATGAAT
TACGCTATACTGTATGATCCCATTTCTTGTTCATATATTAATTCATATTACAGAAATTTT
ATAGCAGGACAGATAAATTATTTTCTTTTTAAATGTGTATTTTCTGGTCTTGCATATTGT
ATTGTTCAACTGATTTTCCTATGTAGAAAAATAAAAAGAAAACAGTGTAGCTCCAAGGAG
AAGGATTTGGGTAAAAAAAAGTTTGGTTTTTTTTTTTTTTTTTTTTTTTTGGTGAGGAAG
ATTGGCCCTGAGCTAACATCTGTTGCTGATCTTCCTCTACTTTTCCATGTGGGGCGCTAC
CACAGCATGGCTTGATGAGTGGTGCCATGTCCACGCCCACGATCTGACCCTGTGAAACCC
TGGGCCGCTGAAGAGGAGTGTGCAATCTTAACCACTCGGCAACTGGGCCAGCCCCAAAAA
AAGTTTTAAGATGTTAATTAAATGCTTTTCCTAGTTGCTGTCTTAGTAATTGTTAATTTT
TCTCCTTTCCCTCTAGCTTGTCCCGATACAGATTGAAATTTAGTGCTGATAAAGTGGACA
CAATGATTGTTCAGGCAATTTGTAAGTATATTACACATGAGGGTCATGCTTTTTCCTGCT
ATCTGTTAGGAAGAGAAAGATCAGTTAGAACTTTTAATAAGTAAAAAGTAAATAAGTTGG
AAAATGCAGAATAGAAAAAGGAAAAAGTACCCATAACTTGACTTGTTGGGGATAATGTGC
CTTATACTATTAATATAAACCAGTTCATTTGACTTTTTCCGTGAAAAATAAGACCATAAA
TAGGATCCGTATTGTGTTGTGTTTTGCCTTTTTTTACACCTACCTTTATAATAGGTCATT
CTCCCATTAAGTGGTTTTTGGAAACAGCAAAGACTATAAACAATTTTCAGTTTTAAACTT
CTCTTTAAACAACAATTGCATTTCTAGATAAAGACTCAAAAGAATTGAAAGCAATACTCA
AACAGATACTTACGTATCTGTGTTCATAGTAGCATTATTCACAATAGCCAAAGGGTGGAA
ACAACCCAAATACCCAGTATCGAATGGATAAACAAAATGTGGTATGTACATATGGTGGAA
TGTAACTCGTCCTTAAAAAGGAATTAAGTTCTAATACATGCTACAACATGGATGAATTTT
TTAAACATTATGCTAAGTGAAATAAGCCACACACAAAAAGACAAATAGTGTGTGATTCCA
CTTATGAGGTACGTAGAGAAGGCAAATCTAGAGACAGAAAGTAGAAGAGGTTACCGGGGC
TGGGGGAGGTGGGGATGGGGGGTTATTTAATGGGTACAGAGTCTCTATATGGGATGTTGA
AAGAGGTCTGCAGATGGATAGTGGTGATGGTTGCACAACATTGTGAATGTACTTGATGCC
ACTCAGTACACTTGAAAATGGTTAAAATGGTAAATTTTGATTTTGGCACAATTAACCCTT
TTAAGTTCCTGTTTTCTTTTTCATTTTAATCTATTGCAGCCTTATTAGATGACTTGGATA
AAGAACTAAACAACTACATTATGCGGTGTAGAGAATGGTATGGCTGGCACTTCCCTGAAT
TAGGAAAAATTATTTCAGATAATTTGACATACTGCAAGTGTTTACAGAAAGTTGGTGAGT
GGCTATATCCTTTAAGGCATTTGCATCCTAAAACATTAGAGTGACTTTTTTCTCACACTT
CCCGGAGTGTTTTGAAACTTATGTATGTTTTGAGAGTGTAGCAATATTAATGTCTGTTAG
ATATCAGAAACAAAATTAGCTCTGATATTATGGCCTATACAACAGAGAAATGGTTTTCTA
ATTTGGTGTTTCTTAAAATGACTTCTTATGGTGGATGTTTCTTATGGTGAATGTTTCTCA
TAGTGAATGTGCCATTAATGGGGCAACTGTAAACCTGGGGGGATATCCTGAAATATATTA
ATAATAATCAATTCTAAAAGTGGTATTGCTGTCTATACTGTTAGTATTATCTCCTATACT
AATAGTACAGATATATTATTTAGAACCTGAAGAGTGTTGGTAAATATGAGTTACCTGGCT
CATATTATATTACCGTATTACCAGTCCAAGAATATAACCTTAGCTATCAATTGTCTATCA
CAATATTAGCCCTATTTCATGGAGTATATTGTTTTTATTCTAAATCTATAATTTGTATTT
TTGGAGGGAGGTGGTGGGGAGAGATTTTAATCTCTAAAATCAAGCCTTGACATAAGGAAA
ATTATTACTAGGTCAAACTTGTTTGCTTTTTGTTTTGTTTAGGCACCCTTTTCATTGGCT
TATCTCTACTTTTTCTTTTGACTGTTTGGTGGATTTTATTAATTTATTGAAGAGTGATTC
TCCCTCATCCTCTGCAAACATTCCATAGGCGATAGGAAGAATTATGCCACGGCCAAACTT
TCTGAATTACTGCCGGAAGAAGTGGAAGCAGAAGTGAAAGCGGCTGCAGAGATATCAATG
GGGACAGAGGTTTCAGAAGAAGATATTTGCAACATTCTGCATCTCTGCACTCAGGTAGAC
TATCCACATAGAGAAACTAGTTGTGATGGTACCAGCTCTGTAACAGTGACTTTCTGATGG
CAGTGATGATTTTTCAACTTATTGTTCACCTGATAAACAAACATGAAGGTGTTCAGTCAC
TACCTCATCTGATGCCATCTTGATTTACGTAGTGTGGGAAGTATATACTAAAATGAAGTT
GAGTCCTGTCTAATTTATTTGTATTGTATTATTTGTATTCAGACAATATAGCATTGTCTG
AATAATGAATTATAAATCCATTAAGAAAGCAGAGAAGTATAGCTCGAGTTGTTTGTTTAT
TTTTATTATTTATTTATTTATTTATTTGAGGAAGATTAGCCCTGAGCTAACTACTGCCAG
TCCTCTTTTTGCTGAGGAAGCCTGACCCTGAGCTGACATCCGTGCCCATCTTCCTCTACT
TGATATGTGGGACGCCTACCACAGCATGGTGTCCCAATCAGTGCCATGTCCGCACCCGGG
ATCTGAACCTGCGAACCCTGGGCCACCAAGAAGCAGAGCGTACACACTTAACCCCTGCGC
CACCAGGCTGGCCACTGTTTATTTTTTTAAGATTGGCATGTGAGCTAACAACTGCTACCA
ATCTTTTTTGCTTTTTTCCCCCCAAATCCCCCTAGTACCTAGTTGTATATTCTAGTTGTG
GCATGTGGGACCCCGCCTCAACATGGCCTGATGAGCAGTGCCTTGGCCGTGCCCAGGATC
TGAACTGGCGAAACCCCGGGCCACTGAAGCAGGGTGCGCAAACTTAACCACTCAGCCATG
TGGCTGGGCCCAACTCATTCTAACTTTTGTGTTTATAGCCTGTAGTGAACTTTTTTCCCT
CATTTGGGGATAGCTATACAAGAATCAGGATGACACAAATGTCTAGCCCTTGGGATTTTT
TAAAATAACAGTAACATTGACTGACATTTTTAGGCAGTGTATTAGATTGTTTACCTACAG
TATCTAATAAAATGTTCAACACAGCTCCTTTATAGGAAGCTGAGGTCTGGAGTGGCTAAT
TTTCCCAGGTTTGCACAGCTGCTGTGTGATCATTTAGGACTGCATGTTTTAGACATGTGA
ATTTTAGACTGTTTACTCTTGAGTCATTTATGACCTATTCATTTTGTTTCTTATACTAGG
TGATTGAAATCTCAGAGTATAGAACCCAGCTCTATGAATATCTACAAAATCGAATGATGG
CCATTGCACCCAATGTTACAGTGATGGTTGGGGAGCTAGTTGGAGCACGGCTTATTGCTC
ATGCAGGTGATGATTTTAGTTTAACTTGTAAACGTGGCTATTTAAAGTTGAGTTGTTTTC
TAGTTAGCATTTTTTTATTTTAATCTTTAAACTACAGCTATTAAAGAAATTTTAAATAAT
AGTAATAAATAGAGGTAGAAGGTGTGTGGGTGAGGACTAAGGACCAAGTGTTCAATGATG
ATTTCTGTTTATATGCCCGATTTCCTTTTGGATAATGAAGGCATCTTTAGTCACTACCTC
TTCTGAGACACTTGGCGGTCCATTTTCAGGTTATAACGGTTAATTAGAATAATCAGATGA
ATGCAGGAGGATGAAGTCAGTTAATATTTTATATTAAAAACTCATCAGATTAAAACTTGA
ATAGTTTTAAGAAATCACAACAGATTATATAAACCCTTGATCAAGGATCTGTCACTATTG
GAAGTGCTATTTTAATATGTTTGAAAAATATATATATATTTGACATCCAAAAATATTTTG
AATAAGTGATAATCAAACTTAATGTATGTATGGTGATATTATAAAGACAGTATACTACCA
AAAATGCTGTGTAATTGAATACTTGCAAATGCAGTGAAGTACTAGATCGTTGTTTTATTG
GAGGCATTGTTATCATCTATCGAAGTGTTCATAGCTCCATTAGCTGTATTGTTGATCAGA
CAAATAAGTGGCATTCAGATACCCTCAGCTACAAGGTCGGGATAGTCTGGGCTGATTTTG
TTGTCCACATCCAAAATTTCATAGGTTTAGTTAAACTCGCAACAATAAGAAGTGCAAGGA
TTAACAGAAGTGTGTGTTTGTTGGTTTTAAACGTGTCTGGTGGTTGAGTGACTGTGTTAA
CGTTGGGGGTGTCTTCTGACAGAAAATCTGCACAGCGCATCTAGCAAAGCAGCACCTTCT
GGTGTCTGATTATTGTAAGCATATCTCCTCGTTCGCATCTTAAACAACAGCAGTAAATAA
AACGTGAGAAATTTATCACACAGTTCTAGAACCAAGATATCCCAGTAATTTTCCTTTTAT
TTGTATGTTTTTTCATAGCTAAAGTAGAATATTTGAAGTCCAGAATCTCAGAAAAATAGG
GGCAAGATTGGAGGGTGTATGAATACATATGTTTGTATTTCTCCCATGGTATTCTAGTGG
AATGCAGAATGATAATACCTTCCTGGGTGACTAAGTAAAATTGAACTAATCAGCTTAACC
TTCAGTTTGTCGTTGACGTTGATCGCAGACCTCTCTGCCTGCGGTGCTGAGAGACGGAGC
TCAAATGCGGAGGCGTCAGGACTTGTAGGGCGTCCTGGACTGTGGAACCCTGTGTCGCGG
CTCTAATGCTGAGCCTGCATAGGTCTTGTGTTTACCACGTTGGACGTTCAAATACTTGGA
AGTGCGTTCCTGTTGAAACTACTTCTTTTCTTTTGAAGGTTCTCTTTTGAATTTGGCCAA
GCATGCAGCATCTACAGTTCAGATTCTTGGAGCAGAAAAGGCACTCTTCAGAGCCCTCAA
GTCTAGACGAGACACTCCTAAATATGGGCTCATTTATCATGCTTCACTTGTAGGCCAGAC
AAGTCCCAAACACAAAGGGAAGGTGAGTTACAGTTTTCCTGAGGTGGGCGTTTTTCTTTT
TTCTCCGAGCCACCCATATTCCTCCTACTCCATAGTATGCAATAAATCTTTTCCTCTTTC
TCATTAAATAGAGAATGGTGAATTCTTTAAATAAAAAGCACTTTTGTACACTGAAAGAAA
AGTTAAAGTGTTATTGGTCCTGTTAAAGCCATTTTCTTTCCCTCTGTATTTTTCTAGAAT
CCACTTGTTGGTGAGGGGTGGGGTAAGTTGCACATCAACATGTGTGTGTTATAAAAATAA
TAGCACATGCACTGTGCTGAACACTTGATGGGGCTTCAGGGAATTCTTGTAATAACCCTA
CAGGTGAGGGAACAGGCTCAAACAGATTAAGTTCTTTTGAGCTTTTTCGTAGGATACGTA
CTTTAACAGAAACTGAAATTTTATAAAATTCAAAGCAGCAATAGGAGAAATAAAGGGTTC
AGTAAAATAAAATCTTAATTAGCTTGAAAAAGGGCTACACTTTTGTTGGATGACCTTGTG
TAGAACTAATGTTACTGAGTAGAAACTAAAGACATTAAAAGAACAATTTGAGATTGTTTG
AGACATGAGCTACTAGAATATCTCTTAACTCACCAAAATGATGGTGGTCGTGTGTAACCA
GTTAGCCATTAGATCATAGCAAAGATTCCAATACAGGATAGGAAGCTCCAGTTGTATGAT
TCATGAAACTTCGGTAATTCCTGATTTTAAAAAATCCTAGCATGAGTGGTAGAGTTGATG
ATTTTTTGTAGTTTTCTTGTGAATTAATTAACAAGATTTTTACATGTCAACTTGGAATAT
AGTTTGGATGCCTCTAACTTCGGATTCTCTGTTAGATTTCTCGAATGCTGGCTGCCAAAA
CCGTTTTGGCTATCAGGTATGATGCTTTTGGTGAAGATTCCAGTTCTGCGATGGGAGTTG
AGAACAGAGCCAAATTAGAGGCCAGGTTGAGGACCCTGGAAGATAGAGGGGTAAGAACCA
CATCCTGCCTTTTGCAGAAGTGTTAGCTGTCAAAAGTTAATAAACTGACTAGTTTATGTA
CTTATTAATTCCACCTCCAAACAGTTCTATTTTGATACATTTTAGTTGTCTAATAAATTC
TTTTTGTGCTGGCTATTAACAGTTTGCCTTATAATTTATCAGGAATTGATAGGGGGCAGC
CCAGGGTTTCGCCACTTCGGATCCTGGACGCAGACCTAGCACTGCTCATCAGGCCGTGCT
GAGGTGGCATCCCACGTGCCACGACTAGAAGGATCCACAACCAAAATATACAACTATGTA
CTGGGGGCTTTGAGGAGAAGAAGAAATTTTTTTAAAAGAAGAAAATCTTGAAAAAAAAAA
AAAGAATTGATATACTAGAGGATATGTTATAAAGAGATTATGCCTTAGAAAGTATTGATA
ATTTTTTCTTTCCTTAGATAAGGAAAATAAGTGGAACAGGAAAGGCATTAGCAAAAGCAG
AAAAATATGAACATAAAAGGTAAGTACATTTAGGGGAGGGTGGATGAACAGTCTCTGCTT
ATTTAAATAAGGTTGACTGTTGACAGCAGTTGTTTTATTATAAACTTAAGCACCTCAATA
TCCCCTAATTTTTTTCTTTCCAATTTACAATTCTTTGTAGTCACATTCTGGTTTTTAATC
ATATGTGTATATTCTCACATTGTTGTAATAAGTATACATAGTATACTTCTTTTGGCAGGT
TTTTTCTTTCCTGATAGTTAACTTAATCATTTTCAGATATTGATATTTGAATATTTGTCA
TTCATAGCTCCTGTATAGTATACCATTTATCAAAAAGAAGGTCCATTCAGAGTTAATCCA
CAATGAAACGTATTTTTTAAAAAAGAGTCAAAAGACTGAAGTCTAAAAATGGCTGAGAAG
CATGGAAACCTTTCAGACCTCACCATGAAATTAAGAAAAGAAAGTTATGTGTGGGGAGAG
GTGTTTGGTTATTATTTGAGGTAATGCTCAATATTGGTGAGGCTGTGAGAATGTGGTACA
ACTTTTCTGGGAAGGAGTTTGACAGTATGTATCAAGAGCCTTAAAAGTACTGCTTGTTGG
GGCTGGCCCTGTTGCCGAGTGGTTAAGTTCGTGTGCTCTGCCGCAGGCGGCTGGGTGTTT
CGTTGGTTCAGATCCTGGGCGTGGACATGGCACTGCTCATCAAACCACGCTGAGGCAGCG
TCCCACATGCCACAACTGGAAGGACCCACAACGAAGAATATACAACTATGTACTGGGGGG
CTTTGGGGAGAAAAAGGAAAAAAAAATCTTTTAAAATAGATATATATATATATATATATA
TATTGCTTGTTGTTAACCCATAAATTCTACTTTGAGGACTCTTGTAATCCGTTAAGGTTT
TTTTTTGGTTGTTTGTTTGTTTGTTTTTTGAGGAAGATTAGCCCTGAGCTAACATCTGCT
GCCAATCTTCCTATTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCTGTGACCATCTT
CCTCTACTTTATATGTGGAATGCCTACCACAGCATGGCTTGCCAAGTGGTGCCATGTCCA
CACCCAGGATCCAAACCGGTGAACCCCGGGCCGCAAAAGCGGAATGTGCACACTTAACCA
CTGCGCCACTGGGCCAGGCCCGTTAAGAATTTTAATAGTAAAATCTTATGCTATAAGTGG
GTAGGAAGAGCAATATATGGTAACATCTCATAAATATATATTTTTTAAATGTACACATTC
AGAAAAGTTGTTTTTCTTTATTCTGGAAAAAAACAAAGGTATTCAGTTGTGGGTGTTAAC
ACTTTCTTTGTATGTTGTGAATTTTCCGAGTTTTCTACAATGACCATATATTCTATAATT
TTAATGTCTAATTTGTGGTCTTTAGTTGACAAATGTGGATCTTTGTTTTTTAAATTATAA
CTCACAAAAGTTAACCTATAAAAGTTAAATGGCCATGAGTCTACAGGTTAGCTTAAGAAA
TAGAATATTCCTTAGCTTGTTTTGAACAGGTTTTTAGTATTCCTGTGCCATGATGCTGAT
GATTTTAAACACATGCACTTAAAGCACTAATTATGAGATTTAGTTCACATTTTTGGCACC
CAATACTTCCATTCCATTTGTTCTTTCTGCCGTGTTAGAACAAAAGCCAATGGTGGGTTC
CAGGCAGCCCTTTGGTCACGTGTCCTCTTGCTGCTCAGCCTCTTGGGGTCTTAGGGTGAA
GTCTTCTCTGTTTAACTTGATTTAGGCCTTCTGTTTTGTTTTCTTTGAATTACCCAGTGT
TCTAAAACTTGAACTGGTTTCATTTTACTTTCTAGTATAATCATTTGGTATAAGAAATTT
TCTCCCTTTTTTCCCTGTGCTGAGTGTAGTGACTGTGGTACAGAAAAATATTCATTGATT
ACTAAACCAGAATTCATTTAGCTACCACTTATCTTTTGGAAACTATTAGTTTTCATAAAC
TACCCCAAAGCCAGTAACATGAGCGAGCATATTGTGTGCTTGTGTAGGTATTATCTAATG
GCATTTCCTTTACATCTCTTTAGAATTATTTCACTTACAGATATTTGTAGAGATTTTCTA
AAATTATTTGGCTCTTTCAGTGAAGTGAAGACTTATGATCCTTCTGGTGACTCCACACTG
CCAACCTGTTCTAAAAAACGCAAGATAGAACAAGTGGATAAAGAGGACGAAATTATTGAA
AAGAAGGCCAAAAAAGCTAAGGTTAAAGTTAAAGGTTAGTTTGACTTTCTAAAATGTCAT
TTATACTCCTATTCCTTAAGAAGTACAGACTCGGTAAGTCTTGGGAAGGTACGTGCTGTT
GAACTTGATTGTGAAGCCACCCATGTGGAAGGCTGGCCGTGTTCTAATAAGCCGTCATAT
TCTCTGGGAATAGTTAGGATGTCGGTAGATTCATCAGACTCCATGGAGAAATGTGCGAAG
CGTTTCTTTGAATATGTAGAATTACATGTTATGCTAAGTATACCAAAACTTCCATTTCTA
CTGTGAACTATTTTGAGAATCAGGTTAAAATAGAAGGAAAAGGGTATATGGTTTCTAAAT
TGGTTACTGAAATATTTTTCTTGTATAGTTCAGCATAGAATTGGTGTCATCAGTGGTTTT
CTGTGTTTCTCTTGTATGGGTGGACTGAGCAGCCTGCCGTCATAGTAATCGTATTCAGTA
GGTGCTCTCTAGCGGCCTGGGCTGTCTCGCAAAGTTGACAAGCAAGTACCCCCATTTATT
AGCTGTGCCTCTGTTAGAGCACCAGCCAGCTACTCTAGCAAGAGAGTCAGGCGTTAAAGC
AGTGATGTATTTAATTTTTGGTTTCTAAATAGCTTAGTTGTCCGAAGTGTGCTGTCAGCA
AATGTGGACTCTTGCCCTGGATGAAGAAAATATAAACCAGTTATTTAACTCCTGTTTCTA
TTTCCTTATTACACAGCAAGGAAATCCCTAAACCCATTACTAGCATTTGAAACACCAAAC
TCCAGATTTGTATCTTCACTTGTATATGCATACTTTTCAAACTTAACATTCTTGAATCCT
TGCCACTCCCAATCTGTTAACTCCACAATTTTCTCCATTTTATAAATGGCAATTCTAGTT
GCTTTGGCCTTTAACCTTAACTCTTCTCTTATAACCCGGATCACTCTGGCAGCAAGTCCT
GTTAATTCTACTTTGAAAGGATATCCAGAATCTAACCACTTGTATCCACCACTGCCGTTC
TTAATGTAGCAGCCACAGTGGCACCCTCGTCAGCTCTCTGATCTGATTCTGCTGCAGCCA
CACTGGCCTCCTTGCTCTTCCTGGAACCTGCCACCTCCCCCTTCTCTCCCAGAGTAACCT
TAGCATTTGCTCTTCTCTCTACCTGGAATATTTTCCCTCAAAATATGTCGTCGTTTACTC
CTTTGTCTCTTTTAGATGTTTGTCTGACTCTGTTGTCTAACATGTCCATGTGTCGCCCTC
CTCAGTGTTTCTCTTCCTGCTGTATTTTTATCCTTAGTACTGATTACTGCATAAAATATC
GTGTAGTGTATTGCTCATTCATTTATTTATTTACTTTTGTCTCTCCACTCTCCTACAAAA
TAAAAGATTCATAAGGACAGGGATTTTTGTCCATTCCATCCCTTTCTGGATCTCCAGTTG
TCTGGAATAGGGCCTGGCATATTGTAGGTGCTGAATAAGTATTCAGTGAACAAATTTCTA
ATGAAAGAAATGTCCCGTTATTGAGTCTTTGTTCTAACATGCCAGGCATCGTGCTAAGTA
TTTTGTATGTGTTATCTTAAGTCCTAGTAAGAATCCAGTGAGAGAGACATTGCTGAATCC
CATAGATGAGGAAGTTGAGTTTGCAGAGCTTGAATGACTTAGTGCAGAGGCATCGCGGGT
TGAGTGAGCCCAGGCCTCCTCACTCCAGGGCATGGCTTTAATTGTTTCCAGTGTAACTGA
CTGACTGCCAGAAACAGTGGGTTTGCAGATCGGAGGATTTGTTTTAATCCTAATTCCTAC
ACATAGCTACATGATCGTGAGAAGTTTACTTCTCTCTGAGCGTTAAATCATTTATCAAGT
TAGTGGTGATGGACTAGGTGGGTGTTTGAAGGATCTTTCCAGTTAATGATATAATAAACA
CTGGATCGTTGACCAGATTGGCGGGGGAAAACTAAGACTCAAAAGGATTTTGGGGGTGTA
AAGTCTGATAGAATGTTAATTGTTGTGTCTTTACACTTACCCTCCTCAGTGGAAGAAGAG
GAGGAAGAGGATGAAGAAGGAGTGCTCGTGGTGGAAGAACAGGAGACATCTGTGAAGAAG
AAGAAGAAAAAGGACAAAAAGAAACACGTGAAGGAAGAAGCGCTTTCTGAGGAAGAACCG
TGCACCAGCACGGCAGTTGCTGTATGTGCTCTTACTCACCATTACTTTATTGGCGTGGGC
AGGCTCTCCGTATTTCATTCTACTCCCTTTATCAGAAACAAGCAGGCAGTGAAAAAATGG
TTTTCATTGGGCCAGCCCCAGTGGCGTAGTGGTTAAGTTCGGTGCACTGTGCTTCAGCAG
CTCAGGTTTGGTTCCTGGCTGCAGACCTGTACTGCTCCTCTGTCTGGCCATGCTGTGGCA
GCAGCTCAGATAGAAAAAGAGGAAGCTTGGCAGTGGGTGTTAGGTTAGGGCGAGCCTTCC
TCAGGGGAAAAAAAAAGTTTTCATTGATGGTGAGGTAAAAGTAAAAGGACATTGTTATAT
TTTAAGGTCCATTTCCCAAACGTAGAATCTTACTATAAAATAGACTTGCTTTGAGGAAAG
GAGAGCATATGATTTGCTACAGATCGCTTTCATAGAGGTGGTTTTTATATTTTAATCTTT
CCCCAAATTTGTTTTCAAGAAAAGTAGGTCTACTTTGCTTTTTATAAAGAAAAGTTATTA
TTACTCACCTATGTATTTACAGCTCTTTCAAAAGCATTCTTGTTGGTTATTTGCAGAGTC
CAGAGAAAAAGAAGAAAAAGAAAAAAAAGAAAGATATTGAAGACTAATCAAAGGGAACCA
TCATTGAGTCTGGATTGAACCTGGATACATTGTGCTTAAGATTCAGTCAGACATGTACCA
GACATGGTTTCTGAAATAATCCAGGGGAGGTTGGGTGACACACAGTGATTAATCGGCTAT
AGCTTTTCAAGCCTATTTGTGTCTTGACAGCAGCTCTGTTAACTTTATTATGTCATCATT
TCTTAGAGTCCTTGTTATACAAATAAAAATATTTTCTTTGTATTTTAAGGCAGTTCTGTG
ATTTCTACATTTTAGATAATCTTTGGCCCTTTCTGTATTTTATTTAGCATTTGATGATCA
TTGTTTCGATAATTATAGCTGAAAGGTGAGAGTTGTGCATCATTCATTTGAAACTTAGCC
TTTTGGAAGGCAGTGGTTAGATTGACCAATTTAAGAACCTCACTCAAATATGTTTCTCTT
ACCTTTTTGGGCTGTCTTTCATTTCTCTCCTTTTCTTCTTTCTGCCTCCGTATTTATTTA
AATAAAGCTGTGTTTTGTGTTCAAAATTTTAAAATTAGATGAACAAAGCTTTCCAGTATC
TCTTCAGAAAGAAAAAAATTGTGTCCCTAACTTTACTTGTTCGCAATTCTGAAAGGTACA
ACAGAATAATTGTTCACGTAAACCTTGATTTGTTTCTAAAGTGACTTTTTTTAAAAAGGT
AATACCAGATAATTTTATAGTGAAGAATGAGGGATAAAAGGAAAACAAGATGAGAAAAAA
CGTCGGTAGGAGTAAGGTGTAAACCAGGACATCAAACACCAAAGAGGAATCTTTGTTTCT
AAGAAATAGTGTCCAGTATGTGAACCGCAGCCTGGCTGACAGCTGTGTCGTCATGACAGC
ACCAGTTTCGGAAGACTGTTACGTCTTGCATTCCTGTGTGTGCCACAGGCATCTGCTGAA
GCCCAGTTCAAGAAATGCATCCAGCAGGCGGAGGGGCCAGAAGGACTACAGCTTTGAGTT
CCACCTCTGCTGCTCATGTAAGCAAGGGTAAGCCAGCAGCCCCTCTTAACTCCAGTTCAT
CACTCATAAATCAGAGAGAATGGTGTGCTTCCCCTCTCCCAGGAGTGGTTTGCAGGAAAT
GAGATGATGCAGATTTTCAGAGAGAGAAATACATTTCAGATCTAGATATTTTGACCGAAG
CAAATGCTGCATGAAGTACACGTGGCCATTCCTAGATAAAGTTTGGTAGTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1086, 4200..4252, 7921..8042, 10056..10192, 12136..12200, 13119..13253, 14008..14153, 15299..15425, 16838..17001, 17855..17989, 18437..18498, 20600..20733, 22729..22880, 23456..23712
1001..1086, 4200..4252, 7921..8042, 10056..10192, 12136..12200, 13119..13253, 14008..14153, 15299..15425, 16838..17001, 17855..17989, 18437..18498, 20600..20733, 22729..22880, 23456..23503
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved