Equus_caballus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Equus_caballus RANBP1
Equus_caballus
RANBP1
Un0002
SNORA77
6088..6213
7824
TCGCATTCACATCTCCGCTCGCACGTGGACGCGAACGAGGAGCCGGTTTTTATCGGGCT
CGGCCCACTGGCAGGCTTTCCCTCCGGTCCCTCGCTCACGCAGCGCTTCATTCATTCTGT
TCTCGTGTCTCGAGCCGCCACAGGCCTCTGCGGCGGGAGCTGGTTCCGGCCGGGTGGACC
GGTCCTGGACGCACGGACCAGGGCGGGGGCGGCTCTGTGGGTTGCGGTGCCTGCCTGGGT
GAGCTCGCGCGGCAGAACCGCAGTGCCGTCCCACCGAGCAAAGCGGCGAAGGCTCAGATT
TTCTTTTTCGGCTTGAGTTTGGTAGTGAAGTCTCCAGATTTCTCTTGGACTTGCAGATCC
CCAAGCCACGTGTTCTGTAAGACTCAACCCACGATATCCTTTGTGCCTCATAGCTATCTT
AGCTGGATCGCAGTGTTAGGGCTCTTATTATGCGATTTCTTTTGACTTACCAACTTACCA
GCTTCCGGAACCGAGACGAAACGGCTGATAAACCTGTGAATTCTGTGTAAATCACAGCAG
TCCCATAACAACTTTTTTTTTTTCTAGTAAGCAAGAGCACAGTTTTTTCTCAACCAGGAA
GAAGTCAAAGGGTTGCTCTTTGTTTTAAGGGTAACACTCCTTGAAGCTCTTTTCGACTTA
TCTGTCTTTTAATCTTCACTGGGCAGTAGCATCATATGTGTTTTACAGAGGAGGAAACTG
AGGCTCAAAAAGATGGGGCAGTTTTCTCCAGGCCACTGGGCCAGGAGGTGGCTGAGTTTT
AGGAGCCCCAGCCGGTCTGCACAGATGCGATTGATGCCTCGGGGGTGGGTGCTGAGGTCC
AGTGTCTCCCTTTGTGCTGGGGGGACATGCAGACCTTTCCTAGTGTGGAAGCCTTCAGGC
TTAAGTTCTTCCTTTCGAGTGAGGCCGTTTACTAGCAGGGATGCACTGGTGAGGCCTGGT
TGGGGTCACGTTCACAGCTAGCACACTCACCTCCACACCTTCCTCCACAGGACACCCATG
AGGACCACGATACCTCCACCGAGAATGCAGATGAGTCCAACCATGACCCCCAGTTTGAGC
CCATAGTTTCTCTTCCTGAGCAAGAAATTAAGACGCTGGAAGAAGATGAAGAGGAGCTTT
TTAAAATGTAAGTAAGCTGATGTTGCTCCAGAAATAGTTATCTTTAGTGTAAGACTGAGG
TTACGGGTTTTTTGGGGTGTTAAGGTCTTGGTCGGACCTTTACTCAGACTGAGGCTGAAG
AAAGGGCCTGGAATTGTGTGATGACTAGTCCCTCATGGAAATCAAGGCTGCTGAGAGTCC
ACTTGTTCATTAACTCTCTTGGGTGCCCCTGCTGCCTGGTGGCCAGTGCTGTGAAGGGCA
CAGTCGCTCCCTGGTATCCTGTCACTGCTGCACTGTACACAAGGGTGCGTCTCCTCAGCA
CCCTGCTCCCGTCTTTGCCACCCTCACCTCTAAGACTCCCATAGCCCCCTTCATCTGATT
GAGGGAGGAGTATCTACAGTTGTTGTTATTTTCCCACCATGGACTTAGCTGTCTGAAGCT
TGTGAGTCCCTGACTCAGTGTTTGGATTGCACAAAATCACGCTTGGAGTTACAAGTGAAA
GTGGGTGCTGTTAGAGTTGAGATTAGTTATTAAAAATTACTCTCCACACGGGGCCAGCCC
CGTGGCCGAGAGGTTGGGTTTGTGCGCTCCGCTTCGGCGGCCCGGGGTTTACAGGTTTGG
ATCCCGGGTGCGGACATGGCACTGCCCGTCAGGCCATGCTGAGGCGGCGTCGCACATAAA
ATAAAGAAAGATGGGTGCAGATGTCGGCTCAGGGCCAGTCTTTCTCAGCAACAACAACAT
AGTTACTGTCCACGCGCTTCTGGAGCTTCGGTGGGGAGCTGCAGCGGCAGAGGTCGTTGA
GAGGCAGTGCTGGCACCGCCGGGTCAAGATGTCCCAATGGTCACAGCACTGCCAAGAGTG
GCCTGTTGCCTCCGCTCAGAATTGCAGCACGTTGTAGGCTCAGTTACACGTTAATGGCAG
TAAACACTGGTGTGTTCCCTGGCCGAGCTCGTGGAACTCCCCTGCTCCCCTCCCTGTGCC
GTCCAAGACACCAGGTTAACATTTGAGTGCTTTGCTGTAGATGTGGGGCCATCACCGCTG
CTGCGACCCCTAAGGAGGGGGGCCGGGGGGGCCTGCACGCCCCGTTGGTCTCCCAGGGTG
GGGGGCATTTCTCTGAGGTCTGGCGCCTCCCGGGGGTGAGGACTGCTAGCGGTGCTATTG
CTGCCCCCTCCCTGCTCTCCCTGGTGTCCTAGACCTGGGCCCTTCCTGAGGGAAGTGAGG
CCTGCAGGGTGGGCCTCTGCATCAGGGCCCTCAGGCTCCAGTCAGCCCTGAGGGCGTCTC
ACTCCACGGGGTTGAGTTTGGGAGAGAGCAGTCTTCTGCGGAAAGGGACCTGTGAGCTGC
GGGGAGGCAGAGGGCAGGTGTGAGGGGGAGAGGAGGGCGTCGCCCCAGCCCGCTGCTTGT
TGCTGGGGCCTTGGTGCCTGGTGAGGTGGGGCCTCGCCTGGGCCCGTGAGGGGCTACCCT
GGGCAGGAGGCAGGGGTCGGACCAGGGCCTGGTGGCCTGAGCAGAGGCCTGCAGCCTCCT
CTCTGGGTGGGGGCCGGGGAGCACAGGGTGCATCTGGAAGCTGAGAGAAGGGCTGGCCCT
GTGGGGCACGGGTCCTCAGCCTCACCTGCTTCCCCTGTGGCCCTCTGGGCACGGGACTGC
CCCTGCTTGGTGGCCGCAGACACGCCCAGCGTACTCGGGTGGGCTGCTTTGCTGAGAGGT
TGGGTCTTTCTGTTGGAAAATGCTGTGACTGTAGAAATCTGTTATCTTTTTTATCGTGAA
GTAAAAACCTGGAGTTCATTGGGCTGTTTTGCCCTTTTGGTGGCGTTTGACTTGTAGTCC
TGGCGGTACAAAAAGGGAAAGGGTGTGTGGAGACGTCACACATAGCCATCTGTGTGATAC
ACAGAAAACGCGTGCTCTTCCCAAGGACACGTTTGACTGACTCGTTCCCGTTTCTCTGCA
CATCTAAGCTCTCGCTTAACGGCTTTTCTTGAAGGCGGGCAAAGCTATTCCGATTTGCTT
CAGAGAATGATCTCCCAGAATGGAAGGAACGAGGCACTGGTGACGTCAAGCTCCTGAAGC
ATAAGGAGAAAGGGACCATCCGTCTTCTCATGAGGAGGGACAAGACCCTGAAGATCTGTG
CCAACCACTACAGTAGGTGGCCGCCGGGCCTGGGTTTGCTCCGAGCCCAGCGCTCTGCAG
TGGGCAGGAGGCTTCCAGGGCTGCGCTCCCAGCCTGGGAGCACACTGTTACATGGAGTGC
ACGGTCGTGGTGTGTTTTTTTTTATTTAAAATAGGAAATGAGTTTTTCCAGTTCCCTCTG
AGCCCAGAGCAGACCTACAGGGAAGGTTATAGCACGCAGGGGTGTGGAGTCTGGGCAGAC
AGGACCTGACAGGATGGACACAGCCCCCCAGCGTGGGCTTGGGACCGTGCTGTGCCTGCT
TGAGGACCAGGCGGGGCGTGCGTGCACATGTGTGCCAGGTGCCTGGGAGGGAGAAGGTGG
CTGCTTGTGAAGGTCATCCTTAGGTGCCTGTGGAACTGCACAGGGAGTGGGTGGTGGCAG
GTGGAGGCCCTTGGTCAGGTGTGATGTAGGGTCCAGGAAAAGCCACACAAAGCCTGGCCT
GTGAAGAGGTGACAGTAAGTACCCTGCCACAGGAGATGTCTGTCTCCCGGCTGTTGGGCT
CTTCTGCAGTGCTGTGAGCGTGTTGAGAAACAGCTGTGTTCTGGGCTCCCTGTCCAGTGT
CTGTATTTCTGGGTGGAAGGTGAGGGGGATGCAGAAGGGTCGGGGAGGGGCCTCTGCACC
AGGCCCCACGTCGCAGCCTGGCTGGCTGCCTGGGAGCAGCTCCTGCAGTGCTCTCGCCCT
CTACCTGGCCTGTCTGCTCTGGCCTGGTCTTTGTCTTTCCAGCCCCTCGGAATCGTTTCC
TCGGGGTCTTCCTGACACCCGTGCTTCTCCCAGACCCTTGCAGGTCACTGTGTTGTTGCT
GAGTCGTAAGTGGGTCACAGACGCTCGATGGACAGGGTGGGTGGTGGCGGGAAGGGGCCG
GGGCACCTTTGTGTGCCCTGTACAGCACGCGGCCTCACCAGGACTGCTCCAAGTTCAGAT
GTGATGTGTGCCCCAGGCTGGGCATGGGCCGTCCCATGTCCCCAGAGACCTCTGCCCCAG
GCGCATAGGCAGATGTGGTTCTGGGGATACTTGTGTTGTTAGGGAGCCTATCTCCTTCGT
TCCCCTTGGGTCTGCCTGGAGCCTGAGGACATGGGGAGTTGGTGCTCATTCCAGGCCATG
TTTCTGTCTTCTATGATGCACGAGCAAGTCACGAGCAGTGTCCACTTCTGGTGTCCTCAT
CCCCCGAGGTCTCCTTGGACAGTGCAAGGCTAAGAATGGTTGCCCTCCTGGGTAGTCACC
CCCCTTCAGGCTTCGGCCTTCCACTGCCCCCACCTTGCCATGGGCTGGGGCCCCGATGGT
GTGGCTGAGCGTGGACACAGCCGTCAGGTGGGCGCCCTCCGCAGGAAAGGCAAGGCCTGC
TTAGCTGGGTCCCCTGCGTGTCCTGGGCCTGGGGGCTGCTCTAGCAGGGGCAGGACCAAG
GGGTTGGGTATGAGTGGCCATGTTGGCCTTGGAATCCTTGTCCAGTGGGGTTGGAGAGCC
TTGCTATGGTGTCCTCGTGGTCCGGGAGCCAGCCACCCTGCTCCCCAATTTAGGACGGTC
CTGGTTTTAAGTGAACATGAGTGTTTTCAAAGAGGACTGGGTAAAATCTGTGTCCCAGAG
GACTTTGTCTAGCCCTAGTTTGTGAACCCCAAATCATCCTTGTTTTGCCCAAAGGGGAAC
CTTGGGTTGGTGACTAGGGCCCCCTTGTGGGGCAGCTGGGGGTGGGTGGGCTGGCCTCCT
GGCAGTTGGCACCACCCTCACAGAGCTTCTTCCCCCAGTCACGCCGATGATGGAGCTGAA
GCCGAATGCGGGCAGTGACCGTGCCTGGGTCTGGAACACCCACGCCGACTTTGCCGACGA
GTGCCCCAAGCCGGAGCTGCTGGCCATCCGCTTCCTAAACGCCGAGAGTAAGTCGAAGGG
CGGCAGGCTGTCGGGGCCTGGCCTGCCTGGCCGCCTGCGTTATAGCGTAGTGGTTTAACT
GCAAACAGAAATGATGTTGCTCTTCCAGGAGAGGTGACGTAATGGGGGCGTGTGGTAGGG
ACTGTCTCTGTCCCGCAGTCTGGTGGCCCCTGAGGAAGGGATCAAGGTCCTGTCGAGCCA
CATACCTGTGGGGCCGCACCTGGACTTTGAGGTCACGAGCAGTGTATTTCCCCTCTTAAC
CCCAGGGGACTGTGCCAGCTGGTCTGCCCAGGGCAGGCATGTCCCCTTACAGTCACCTGA
ATGCCAGCAGAGCCTGTGCTGAGATCCACAGGCCCAGGCTGACCTCTCCCCTGCTTGGGC
ATCTCTCCAGTCCAGATTGTCAAAAGCTAGAGCCAGTGTGCCCTGGAGGAGTTGGGTGGG
TGCCGGGGCTCGGAACCCAGTAGCTGACCGTTGGTGCTGAGCGAGCCTCACCTCTGCATT
GGGGCGGGGCCTGTCTAGGCTACTCCACCACGAGTTGGCAGCAGTGCCTGGTGAGGATGC
CCTGCCCCTGGGTGGCCTGAGGCCATGGTGCTCTGTGCTGCTCTGCCCACCTTGTCACAG
AGTCAGATGGGGAGGGAGGTGGCCCGGCACAGCACCAGCTTCGGGAGGGACTCGGGACAC
TGTACCATCCAGGCAAAAGCAAGCCCACAGCCGTGTCAGATGGCCTAGCTCAGCCTCGGG
TCAGAAATGGCCGTGGGATGGGCGCTTTGTGAATCCTGGCTCTTTAGAGCCACCAGGACG
TGTTTCTCTCACTGCTCAGGCTCTTAAGAAGTCTCCTCTTTTCTTTCTGTAGATGCACAG
AAATTCAAAACAAAGTTTGAAGAATGCAGGAAAGAGATCGAAGAGAGAGAAAAGAAAGGT
GATGTGGCACCTCCGGTGGGGCTTCCCCGCAGACTCACTCTGCACCTGGCTGCAGCCCCA
GGCGGGTGCTTTTTCTGTCTGCCACAGAAACGTTCCAGGGTGCTGTGACCACCTTGACCT
GTCAAGGGCGATGCAGCTGCCTGGGGACATGGAGAGCTCTGGGGAGTGAGCTGGCCGTGG
GGTCCTGAGCACGTGCTCTCTGGCCTGGGCTCATGGCACTTGGGCAAGCAGGTCACGGCA
TCTGACTAGAGCCCAGCAGAGGCTGAAGGGGCTTCGAGATGTCCTTGTGGTCACCTGCCT
ACTTGGGGCCCGATGATGGCTTCTGTAGCAAGTGACGAGATGTCACTGAGCAGCCTGACC
AGGGTCACAGGCATGAGCACGTGGTTGTTGGGGTCACCCTGGAGTCCATCTTGGTGGCAT
AGGGTGGAGAAGCAGGCTGTCCTATGGGGCGTGTGTCCCAGGGCTGCGTGCGGGCTGGGG
AGAGTGGTGCTTCTGTTTTCTTACTGTGTCTCCCTGTGTTTGAGCAGGATCGGGCAAAAA
CGATAACGCCGAGAAAGTGGCTGAGAAGTTAGAAGCTCTTTCGGTGAAGGAGGAGAGCAG
AGAGCAGGCCGAGGAGAAGCAATAAGCTGTCTGCCCTGTCTTCTTTCCCTTCCTTTCTTT
CCCTTTCCTTTCTTTTTTTTAATTTTGCCCCGCCCTTTTTTGTTTTTTTATTCTGTTTTG
TTTTTACAAGGGACTTTATATAAAGAACTGAATTCCAGCATTCAGGTTGTTTTTTCTAAG
TTTTTACCCTGTGAAGTTGACTTCAGAAAATCCATTCCCAGTCATGAAGATGTGCTGTGC
TAACTTTCTTTTCCATAGTGGAAACACTTATTTATAGTCGTCAAGATAGTGAATAAACGA
CACGTTTGAAACCTGCACGGAGGGCAGGACCGTGTGTGCGCCGGCCCTGTCCGGGGAGCA
GTGTGGGCTCCTGCAGGCCCACCACTGCCACTTGCGCTCTGCCGGGGGCTTTGGGCTGCT
GTTGGCCACTGGGGACGTGGCGTGTCTGAGCCAGGGCTGGTGTGGGGCTGGTCGGTCAGG
GAGGCGGCGCTGGGTGCTCTGCCTCCTGAAGGCTCCTGTGCTGCTGCCCTGTGGCTGGGA
GTAGGTAGCTTTTCTTCTTTTGGCCTTTCAGGGAGAGAAACGACCACCAGAGTGCCTTGG
CTTCGCACTGGGAGGCCAAGCAGGCCTCCAGGCTTTGGCCGAGGCTGTCTGGGCTGTCCC
AGCTGTGGTTGGCCAGGATGGCCCTCAGCCCTGGCAGAGGGAAAGGCCAGTCCCAGAGCA
CGCGTGTCCAGTCTGCCGCAGTGCATAGGTGGGGCTCGCCCCTGCGGCCCTCATTAGATA
GCCCACTGCCATCGTGGGAGGGAACCGTCTGTCCGCTTGCTCCCAGCATCTCCATCGGGG
GGGCGTTGTGGGTATCTCCAAGAACTTTAAATGAAAGGATGTTTTCAAGAATCAGATGGT
TAGCGTCATTTGAGGGTTTGTCTTATAGAAAGGTGGTGTGTGTAGACGTCATTCTAAGGG
GAGGATTTTCAGTGTACTGGGAGACTAAAGTGCACGGTCCCACCCATGATAGCATGTGTC
CCAGGGAGACCACCGGGGCTCTGAGGAGCGGTGGCTACCCTGCCCTCCAGCAGGGAGCAG
CAAGTGAGGACCTGACTCTAGAGTGGACACCCTGGATTCTCTGGCTGTTCGCCATTAACA
CGTACCAGAGGTGCTTTACGGTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1146, 3094..3251, 5018..5146, 5992..6057, 6584..6824
1007..1146, 3094..3251, 5018..5146, 5992..6057, 6584..6681
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved