Equus_caballus Locus NAP1L4
snOPY snoRNA Orthological Gene Database
Equus_caballus NAP1L4
Equus_caballus
NAP1L4
12
SNORA54
13470..13592
28066
TACTGCATCTAAGATTAAGGAGCTTCATCACCAGACCTCTGGTTTATTTTACATTTGAC
AACTTCTTTTAGCTAGGCATTTAGATAGGGTTTTGAAACTTCATTAATATAAAATTCTTC
TTTTTAAGAGGTAAATGTCCTGGAGCCCATTTTCAATATTTATAGGCAGAAAGTCATCTT
ATCTGGAGATAGTCTTTTTTTATATGTGTCTTGTAAAAGTGGAGTCCTGAGTATGTTACT
TAGTGTTTTTATACCAGCTCTGCACCTTCAGGGTAGAAGTCATAGAGCGTACAGAATACT
CAAAATGTAAAAATCATCCTGTGAGAGTTTGAAACAAGATGTAAATACCAGTAAATGCTT
TGAATTGTTCTAAAATAATTGGTCTAGCATAAATACATGTTCCTGTTGCTAAAATTTATT
ATGGAGATAAGGTAAATTAGAATTGATTAATTGGGGTCTGGCCCCGTGGCCACGTGGTTA
AGTTCACGTGTCCTCATTTGCCGGCCCAGGGTTTCGCCGTCTTGGATCCTGGGCGTGGAC
CTAGCACCGTTCATCAAGCCGTGGTGAGGCAGCGTCCCACATAGCAGAGCCAGAATGACC
TACAACTAGGCTGTACAAGTACTGCTGGGGGGCTTTGGGAAGAAGATTGGCAGCAGATGT
TAGCTCAGGTGCCAATCTTTAAAAAAGAAAAAGAATTGATTAATCGTTCTTCCTCTGAAG
TCTAGTCATGTTAGTGCCAACAAGAGACATTTTGTATGAGTAAAATTTGCATGCACTGAA
ATGCACAGATTCTAAGTGTACGATTTGATGAGGTTTGACAAGTGTATATATCCAAGTAAC
CAATACCCAATTCGAGATGTAGAACGTTTCCACCCCCAGAAAGATTCCTCTCCCACCTCC
CAGTGCATCCTCGTCCTCCATGAACAACCGAGGAGCACATATGAAAAGCTTTTTGTTTGT
GAATATTGGTAATGTTAATTGTTACAATTATTTTGATTTGTAGGAGATAAAGACATTCAG
ATGGCAGATAACAGGTAAGCCAAAATAGATTTTGTTTATTGGACTTTAAATTTTAGTTGA
TGAGCAAGAGCCAAGCCATATTTCAGTAAGCATCATTAGAAGTTTTAGCTGGTGACTCAG
GGGGGAGGGGAGTGTGTGTCTGTGTGTGTCTGTGTGTGTGTGTCCATAAAGAAATTACTT
CAGACATGAAAAGTTTCCCAAATACTGATCCTTAAAGCCTTTTGTGTGAAGCGGTCCTTT
TGCCCTCTGGGCTTTAACATCTCCCTGGTGGAGTCATACGATCGACTTGACACCATCCTA
ACGTTCTGTAGCCTCTGGGGTCAAGGAAAGATTTTGTTTGGTGGATTGATCTGAAGGTCA
CATTTGGTTGTGTATAGTGTTTGATGTGGTTTATTTTTGGTGAGAGAGATGTATCCAGGC
ATCTTTGAGAACTGTTAGACCTATTTTTATGAAGTTTAATTGTTTTTAGAGACTGTGTGG
CCAGCCGACAGAGCCGCTGTGGGCACTGTGTCCTAACAGCTTGGTCAGGCGGCTTTTCTT
TGGTCGCTTTAGCAGCTGACTGAACTGTAGCATGCTTGGTGGTGGGTTTAGTGGGTTTGA
TTTGAGGACAGGAGCAGATTTTTTGAGGAAAGAAATTGGAGAAATGAAAACTAAGAAGCT
TCGGCCGGGGTTGGAAATTAGAACTGTGGGGAAGGGTATGGGGGGTTGTTAGCTAGTAGA
ATTATTTTTAATAACAAAGAGGAAAGTATCTTGCAGATAACAGACATGCGTGTCCATAGT
TCTCTTCCACCCAAATCTGAAGTCACAGTAGAGACATCTTAATATGTTAAATAAGAAAAG
TGCCCTTGGGCTACTTGTCTTTGGAACTTTCTTTACAGTAATACTTTTTTAAATATATTG
TTTCAGTTTTTCAGATGGGGTTTCTTCAGATTCCTTGGAAGCTGCTAAAAATGCAAGTAA
CACAGGTGAGTTCATGCACACGGAAGTTAACGGGAGGGTTTTCGTGCAGAGCAGAGGCTC
CTGCTCTCGAGCCATTTATTAGAATAATGCAGGTAGCACAAGTAAAGGCTAGCTGTACTC
ACAGATTCTAAGAAAGTCAGAGTGATGAAAATCAGTACTGTGTTTTAAAAAATTTTTATT
ATAGGGAATTGAGACTCTGCAGAAGTGAATTGGATAGCATAGTGCACCTCTGTACCCACT
GTCACTCAGCGTCAGCCTTAACGGTCACCTGCCAGTCTTCACCTGGGCTCTTCATTCTCT
TCCCCTGATTTTCTGAAGCAAATCCCAGATATCGTGTCATTTTGTCCAGAAATTCCTAGA
TGTGTTATTTTTTCCCTCCATTTTCGAATCTATGCAGTCATACTTTTTTTTTCCCGTGAA
CTGTTTGAAAGCAAGTTGTGGATCCTGGCTCTTTTTCCCTAAAACAATTTAGTGTAAATT
TCCTTAAAACTAGAATGAATTCTCCTAACCACAGTGCCATTATCACAACCCAGAAATTTA
ACATTGGTGGAAGACTATTAGCTAATATACAGTCGTGTTGTATTTCCCTGTTTTTCTCAG
CAGATCTTTCACAGCTGTACACTACACTCAAATCCGGGACTCCCCAAGGATAATGCACTG
CGTGTGCTGTCTCCTTTGTTCTAGAGTCACCCCCCACCTTTTTTTTTTTTATTAATGTTA
TGATAGATTGCAACCATGTGAGATTTCAGTTGTACATTTTTGTTAGTCATGTTGTGGGTA
CACCACTTCCCCCTTTGTGCCCTCCCCCCACCCCCCCTTTTCCCTGGTAACCACCGATCA
GATCTCCTTGTCAATATATTAACTTCCACCTATGAGTGGAGTCATATAGAGTTCGTCTTT
CTCTGACTGGCTTATTTCGCTTAACATAATACCCTCGAGGTCTATCCACATTGCTGCAAA
TGTCACCCCCCACCTTTTATATCCTTCATTACAGGGACACTTCAGCAAGGCATGTGCCCA
GCTGTCTGTAGAATGCCTACACTCTGGATAGTCTGGCTTCCTCCTCATTAGATTCAGGGT
AAACGTTTTGGCAAGACTCATACAGGTGACCTGGTGCAGTGGCAAGTGCGTTTAGACCTG
TGACAGTCAATACTGAGGTTGATGACTTGGTTAAGACAGTGTCTTCCAGATTTTTTCATT
GGAAGGGTCCTTTTAGTTAGTAAGTTGTTGGGTGCCCTGTGGGTATCCCGTTCTCCATGA
GACTTTTACGTAGTGGGTTTAGCACCCATTGACGATTTACATTTTACGCATGTATACAGT
TTTCTACCTACACGATTATATACACTAAATACACATACACAGTGCTTCGTTTAGTGGTTG
TGTTTGTTAAAATTGAGTGTCTACTGGGTGTATTCTGCTGCGCACATCCCTTTCTTACAG
AAGGATGGGGAGAACTCCCACATATGGACTACCTTTTGAGTCAGGGGTGGGTACTGAGTT
TGGATTCTGGACGGTGGCAATAAGGGAATTGGTTCAACAAACACTAAGTCTGTGCCGGGA
ACCAGGTGTTGTACTGCTCCGTGGTTACAGCTGAGTAAAAGAACACCTACTTCCCTCTTG
GTATCTTGTTCATTGAAACAGTACAAATGTGTGTGAGCTATATAGACAGTGTGGCCACGG
AGGCAAGTGACTTTTAGTAGGGGGATGGCCCAGGGGCCTTGTGGAGGAGGTGGATTTGGG
CACAAGGACATTGTAGGTTGAAAGTCTGGCACCACCGGTGAACTGGTGAGAGTCGGGCTT
TCCTGGAGTGTGAGCTGGAGCACAAGTGGGTGCTGATTTACTCTGAGGAACAGGTGCCTT
GTCCCTGGCCTTGGCTTCTGGGCTCCACCGTGGGACTTGGAGAGAGAAAGTGAGGTGACA
GGAGATAGACCACCTGAATTTAGGAAGTGATGCTGTCCTCAGTTGGGAGATTTGGGGCTT
AAACACCTAAGGTGAGAACCAGTAACCCTTAGGTACCCTTCAGTAGATTTATAACCACCT
CCTCAGGCAATTAACATAAAGTATCAAATGCCTTTAAAATAAATGTTAAATATTTTCGAA
ACAGATGTTTTCAAAAAGCTGCTTGCTCTATTTAGAATTTAGATAAACAAAGCTAAGTAG
ATTATGTATTGGTGATTTTTGACTCTTGGCTGTTCTGGTGGTCTTATTTTAAATATTTTG
GCCTTGTTTTTCACTCTTGGTAGAAAAGCTCACAGATCAGGTGATGCAGAATCCTCAAGT
TTTGGCAGCTCTACAGGAACGACTTGACAATGTCTCCCACACTCCTTCCAGCTACATTGA
GACGTAAGTATGCTGTGAGTGAGACGTGATAGAACTTGGAGAAACAGAAAAAACCTATTA
TGTTTCCCAGTTCCTTAGAGTCGGAATAAGTGTATTTTTCGTTCAGCAGACATTGCCTGC
TGAGAGCCAGGCGCTGGGCTTCCAAAGACTCTGGAGGAGGGGCCCAGATCTGTGGAAAGA
ATAAGCAACATGTTGAGTCATCTGCTAGGTCTACACATAGTGCCATCCTGTGGCGATTTT
AGAGGACGTGACAGCTTATGTGAGTCATGCGGGACAAGAAGGAGTTAGCAGGGGAAGGAC
GTGCCAGGCAGAGGGCGGAGTGCTTGCTCCTCCACGTGGCTCTGGTTAGCTAAGAGAACC
ACTCCTCCCTGGCTCCCCGCCACGAGCTGGCAACACCAGAAACTGCTGTTTTAGAAGGCG
TCTGTGTCCTGATTTTTTTCTTAAGCTTGGCACCTGAGCTAACAACTGTTGCCAGGCTTT
TTTTCCCCCTGCTTTTTCTCCCCAAATCACCCCAGAACATAGTTGTATATTTCAGTTGTG
GGTCCTTCTAGTTGTGGCACGTGGCACGCTGCCTCAGTGTGGCCTGATGAGTGGTGCCAT
GTCCTTGCCCAGGATCCGAACCAGCGAAACCCTGTGCCGTTGCAGCGGAGCTCGCAAACT
TAACCACTCAGCCACGGGGCTGGCCCCGCGTGTCCTGGTTTTATTGAGGGGGGGACAATA
AGGACACCCACCTTGGAATCCTAGGACAGCCCCCCTCAGGGCCTGGCTGTCTTGCTTCTG
GAAGGGATGAGCAGCTACTGGGCTTCTGTCTTCCAGTCAGACAGAGCTTGGTCTCAGCTG
TCCTGCCCTCCGCAGTGGTTCCCCTACTCAGGGCTTGGTAGTGTTCCCCAAGGCTGCTGT
CATGGGGAGGGGACCCTTGGGATCTGCTTTGCCTTATAGTGGGTTCTCTGGGCGCTGACT
CAGTGGGGCAGGGTTTTCAGATTTTGCGCACTGAATCACTGGGCTGTAGTGAGACTGGGC
GGCAGTACAAGAGCTGAGGATGAGTAGTGGTTTCTAGTCTTCTGGCTTTAGAAACCGAGT
AAGTGGGCAGCATGCTCAGAGAGGAGATGCAGGACTGCGAACAAGGTCTCCTGGAAAGAG
GAGTGTTCCACTTTGGACGGACTGCACGTGGAGTGCCTGTTGCAGGAGGAGAACAGTGTG
TAGATACTGTAACTGGCTGGAGGGTGGCCAAGGAGGGTATCAGGGTCCAGTTTACTTAGA
ATCCTTCTTGTTTTTACTCCATTAAGAAGATTTGAAAAGTTAAAGTATTTTATTTTATTT
TTTTGAGGAAGATTAACCCTGAGCTAACTGCTGCCAATCCTCTTCTTTTTGCTGAGGAAG
ACTGGCCCTGAGCTAACATCCATGCCCATCTTCCTCTACTTTACATCTGGGATGCCTGCC
ACAGCATGGCGTGCCAAGCAGTGCCATGTCCGCACGCGGGATCTGAACTGGCAAACCCCA
GGCTGGCGAAGTGGAACATGCGCACTTAACCGCTGTGCCACCAGGCCGGCCTCTGAAAAG
TTAAAAAATTTTAAATCGTGCAGTTAATGAAGAAAAGAAGCACAGGTGTTACTCTCTACC
ATTTTGTTAATGCTAACTCTGCTGCTTCCTTGTTCTCTTCCACCAACAGTAGTCCTAGAA
AGGTGACTCCAGTTGGGAGTCTGGTGAAGGACCTTACCCTGAGTATAATTAAGGCCTGTG
TACTCATACCCCAGGAGAGGGGTCCTTTGTGATTCAGGGCTGTTTCATTACTTTCTAAAC
TACTCTGTGTGGGAACTGCCTGGTACTTGTGCTGTGCGTGGCTGGAGGATCAGTAAAGTG
TGCAGACTAGTGCCAGCTCTGCCCTGAGGACTCCGCCCAGGTGGAGGCAAACTCAGAGGG
CAGGACCCAGGCCCGCCCAGGGGGTTGTGTGGGTCTGTGACAAGGCCCAGGAATCTGCTG
TTCCTTCCAGATTGTGACCAAGGGTTTCAGGTTAAAGAAATAATTGTGTTGGGTTTAAAA
TGGCTTTTTTCTTCTGATTTATAAAAGTAATACATACAGACTAAAATATTTCTTATAATA
TAGAAAGGTATCAAAAGGCAAGCTGATAGTTATCTGACTAGAAGACAACAACCGCACTTG
TCTGGTTGTCTCCCGTTTTCCCTCGGCATGTCTGTCTGTGTCATGTGACACTGAGCGTTC
TTGGATAGTGTGACTGTGGACAGGCTGTGTTTTAATCCTGTTCAACTTGGCATTGTTTCT
AGCTTTTCACTCTTGCAAATAATATATCAGTGGACCTTGCAGTACATAGATACTTGGTTA
TTTCTTAGGATAAATTCTTAGAAGTAGAGTTACTGGATCCAAAGTACATTTTCAAGCTTC
TTGTGTGCCCTTAAAAAAGATGAGCCAGGGGCCAGCCCCGCAGCCGAGTGGTTAAGTTCG
CGTGCTCTGCTTCGGCAGCCCAGGGTTTCATCCGTTCGAATCCTGGGCCCCGACATGGCA
CTGCTTGTCGAGCCATGCTGAGGTGGCATCCCACATGCCACAACTAGAAGGACCCACAAC
TAAAAATACACAACTGTGTACCAGTAGGGCTTTGGGAGAAAAAAGAAAAATGAAATCTTA
AGGAAAAAAAAAAGAAAGATGAGTCAATGAGATGGCTTATCTCCTTTCAGCCTCAACAAA
CCTGGGATTTTTTTTTTTTAATTGCTAGTTTGTTGAAAAGACAGCAGTTCTTTTAAATTT
ACATTCTTTTGGATATCTTGTGAGTTTGGACCTTTTCTTCCCTGTTTGATTATTTGTACT
TTTACTTTTGTGAATTATCTTTTCAGCTTCCTTTTTGTTTTTTCCTATTGGGATGTTTGT
CCTTTTCTTAATTTTTAGCTTTTAATTGTAAGGATGTTAATTCTGTGTTAACCTAAATTT
CTCCCAATAAAATTGAGAAGCGTGCTGCCTCATTTGGCAGAGATGGATGTTACGTTTTTT
ATTCCCTCTTAGTTTACCTAAAGCCGTCAAAAGAAGAATCAATGCCTTGAAACAGCTTCA
GGTGAAGTGCGCTCATATAGAAGCCAAGTTCTATGAAGAAGTCCACGACCTGGAAAGAAA
GTATGCAGCTCTATACCAGCCTCTCTTTGACAAGGTAGGGAGCTCTGTTAGTAAATGTAA
TTAGTATCTTTCACATCTTTCTTTACATAAAATATCCAGACTTAGTGAATTGTTGAATGT
TACTCTTTCAGCCCTAAAACTTAGAATTGTAAAATAAGTTACGAAAGCACCAGTTTTCAC
AGTCTTTTCATAGACATTATTTACAAACTCATCTTAACTCAAGTTTCTGAATAACTTAAC
ATAAGAAGGTCTTGTTTTTACTCAGAGAAGGGAATTCATCACTGGTGACGTTGAGCCAAC
AGATGCGGAATCAGAATGGCACAGCGAAAGTGAAGAGGAGGACAAACTGGCGGTAAGTTG
TCTTTACTGAGTGCAGCTTACGTTCTGTTTGAAAACTGTTAGGAATCAGAAACCTCTTTA
GCTGGTTTTTAATCACTGATACAGCTTTATAGGATAGAGACCTCCTGACAGTAGGTGCTC
CTTCACCCTCAGGTGGGTTGAGATTTCTTCTCGACAGTGAGTACTGAGCAGCCCCTGGCC
TGGCATCTGGCTTGATGTGCCGTCAGTCAACATGATGAACCAGACACAGTCTCCCCTCTC
TACTGTCTATAGCTGCTCTCTAGAGTACAGTGACCCTGCTTAGGGACCAGCAGTGATGAG
GAAGTAGCCAGGGTGCCTCTAGCCACTTCACGTTGGTAGATTACAGGCCCTTTGGTAATG
TGCCCTGTCCATCGCCTGCTCACAGCCTTTTTCTGGTGACAGATCCCATCCCACTGCCAC
ACAAAGTCCCAGCATGCCACAAGATTACCTTTGCTGGCCTGATTTTATGTTTGGGAGAAA
AGTAGCTTTTTTCTCTTCTGGGCTGGGATTGGTACCAGAAAGTCTCACAGCACTTAGCTC
TCTCTGATGTCTTTTTTTTTTTTTTTAAGATTGGCGCCTAAGTTAAGATCTTTTGCCAGT
CTTTTTCTTTTTTTTCCTTCTTCTTCTCCCCAAAGCCCCCCAGTACATAGTTGTATATTT
TAGTTGTAGGTCCTTCTGGCTCTGCTCTGTGGGTCACCGCCTCAGCGTGGCGTGATGAGC
GGTGCCATGTCCGCACCCAGGATCCGAATCAGTGAAACCCCAGGCCGCCGAAGCGAGTGC
GCAAACTTAACCACTCAACCATGGGACCGGCCCCAGAACAGTAGCTTTTATCCTATACTA
TTAACTTTTAGGGCTTTTTTTTAAGTGTATGGTAGTTTGGCTAGCTGTATATGTTTTTGA
TCTTTTAAAAATAGTGGAACCTGGCCTAGTTGAAGCCATGGCTGTGGATCACAATAGTTG
TGAATCAGTTCCTTATTGCTCAAGAAAGACCTGCCTCTGTTCGTTTTAAAAGCCCCTCAT
GATCATTTCCTCACAAGACTCGCGTGTGAGGAAGCAGCCACACTTTGCTCTGGCTCCACT
GAGTGTTGTGTTAATCTCCTGCCTTTTCCCTGGGGCCATGACGTTAGAAAGACTCCCCTC
CACGTTGCCACCACTGTCATGATTGTCATCACTGTCTTCTTAGACTGGGCCCTCCAGGGT
GCTTGGCATTGTTTTGTGGCTGAAGACAGGGAGTCTGCATCTGGTGGTAGGTGATTGTCC
CCGGGTGGACGTCTAAAAGAGCTAGCACTGGACAGCCTTTCCCAAGTTTGGTGGCATTGT
GTCATCTCTAGCTTCTTGTTCCCTTGGTACAAAGTTATATCATGAACTTATGTCTGGATG
GAATGCCTTGAATGCTTTGTCCTGCAGAAGCATTTGAAATTGTGAGGTGCACAGTGGTCT
GAGAGATACAGATCCAGAGAACAAGGGTTTTAATAGAAGTTGGTGTGGGATTCTGAAATT
ATATTCTGCACTAAGTCATTGAATTATTTGTCAATTTGTTGTCTTGTGATATGTTCTGTT
TTGCATCTTTATTTTTTTAGGGAGACATGAAAAATAAAGTAGTCGTAGCAGAAAAAGAAG
CAGCAACAGCAGAAGAGCCAAACCCCAAAGGAATTCCGGAGTTCTGGTTTACCATCTTTA
GAAACGTAGATATGCTAAGTGAATTAGTCCAGGTGAGCAGATTTCCACCTTGCAGAGAGA
TTTTGGTCTTAAAACTATTTATTTTTTGAACAAGTTCACTGAGTGTTTAATGATTCTCCA
TTGTGGGTGAAAAGGCACTTTCTGTGACCGACCCCTCAGGTGAGTGCTCTTGGTCTCACC
AGGACAGCTTATTACTGCTGGAACCCTCCGTGTGACCTTGTGGCAGTTGTAGTGGAGAGG
GCAGCAGCTCTGAACATTAGTCAGCACTTGTAGTCGGCTTACTTCCTAGGAAAGGTCTGT
TACCTCACCTCCACAAAGCCTGTTAACAGGTCCAAGACCCGTCTTCGTCCTCCTGTGATG
TGAACAAGCAGGAAAGTGTGAGGATGGGAGAGCAGAGTGGAAAAATGGATTTTGTGCAAT
GAAGGGGTGTGTGTGTGTGTGCGCATGAGCATATTTACATGCCTGCACACTCTCACTGGC
ACGTCCTTAAACCTCTCCTTTGATTGATCTTTGAAATTTGAAATGGCCCTGTTGTGTACC
CTTGCTAGTTGTATTAAATACATAGCAAGTTTCTAATATTTTCTTATCATTTCTCTTGAA
AAAGTCTCTATTTAAAAAAAAAGTTGGAATAGGCAGTCATTCTGTTTTTTGTCTTGCCTT
GTCAGGCTTTCTGTAATGAAACGATGAACCAATTAAAAGGTAACAAATTTGACTTTCCTT
GAACTGAATTATGGTAGAAGTTTCTAGAATACAGAAACAAGTATGCCCAAAGTCTCATCA
CCTGATTTGTTGCCTGGGGTCCACAGAGATGGTCATCTCTGCATCTGGACTTGATCCAGA
CAGGTCAGCACGGTGCTTCTCACATCAGAGCACAGCCGTGGTGGCGTGCAAACAGGTCTC
CTGGACTTTGCGTGAGATCTCACAGTTAGGTTTATAAGGGCTTTCAGAAACTTGTGTCAC
TGCTGCCTCGTTTGATGCTTACCTGTAACCAAAACTTAAGAAAGGATCGAAGGAATGTGT
TTCTTACTCCTTCCAAACTCAGGGGACATCTAAAATATGTGGCTCAGAGTAGCCTCTCTT
TTCCCATCTGAGCTTCCTTTTCATATGAAAAGGGGGGGTTTAAGAAAACTGGACCCTAGG
GGGCCGGCCCGGTGGCTCAGTGGTTAAGTGTACCCGTTCCACTTTTCAGTGGTCCAGGGT
TCGTTCGCCAGTTCAGATCCCAGGTGCGGACATGGCACCGCTTGGCACGCCATACTGTGG
TAGGCGTCCCACATATAAAGTAGAGGAAGATGGGCCTGGATGTTAGCTCAGGGCCAGGCT
TCCTCAGCAAAAAAGAGGAGGACTGGCAGTTAGCTCAGGGCTAATCTTCCTTAAAAAAAA
AAACAAAAAAAAAAAAACTTACTTTTAAAGGAATGCCATGAACCAGAAATTCGCTGGGAA
AATGGAATAATTATGCTAGAACAAGATTCTCACCCTGGCTGTATGTTAGAATCACCTGGG
CAACTTTAAAACTAAATAGCAACATCAGTGCTTTCCCTACCTCCAAGTCAGTGAGCATCT
GGGGTGTTTGTGGAGGTTCTTATCTGATTTTAATGTGCCCCACGGGTTGAAAATGCCCGT
GCCTATAGAGCAGTCGGAAAGACTCCTGAGTTAGTTTTTCTCATACTTTAATAGGCCTAC
CCATCACTTGGGCATCACACAGAGATGCAGGTTCTGACTCTGGGTCTGGGTGGGCTGAGG
GCCTGCACTTCTAATATGCCCCCAGGTGGTGCTGATGCTGCTGGGTGGGCACACACTGAT
TGGGGGCAGGGTTGTCATGATGTGGGCTTTTTGGTGCCAGTTAGGTGACTTGATTGGGTA
ACCTGGCTCCTGGTGGTGCCTGGCCAGCTAGTTAGTAATCCAGGGATGACCATGGCTGCT
TCCCCCATAGCATTTCCTTGGGTTTTGAGAGTAGTACCACAGTTAGCCATGTGTTAATGA
GGTGTCTCTTTTCATTCTCCCCAACACCTCTATGTTAGTGCCAGTGCTTTTGAGAGTCTC
CTTATTTAGGGCATTGCATTATGCTCTGGGCCATATGAAGTTCTTGGCCCTCAAGATACG
TGGCTGGTTGAGGAATTTAAGAACATAATGGTAATTTCATGAATTTTGGGAAAATACCAG
TGGGTACTGCGAGTTTGAGTGGGCTGAATGTGAAGATCCTGCTCCGTGTATTTGGAAAGC
ATCCTAGTGATCACGTCCGTCTCGGCAGTTTAGAACGAGGCGTATGTGCCAGACAGCACT
GTGCGTAGTCTGCAGGCCCATTCTTATGTGCCGACTTGAAAAACTGTTTTTGGGTTATTT
TTTGTCTAAACTTGCTAGATACCTTTGTTGTTGCTGTTTTTTGTTTTGTTCTATGTTAAA
GGAATTTAAAATTGGGAAGTGGGTAGTTTAGTTATAAGACAATTTAGAACTTAATGGAAC
CTCAAGAAGTCCTTAGGCTCTGTCCCCAGGCTTCAGGGGTGAAGGTTTCAGGGGTGAAGT
AACTGTCTTACGAATGAAACACCTGTGTTAGTACTCGCTTACTGGGTCTCAAGCCTCCTC
ATTCCTTTTCAGATTTTTCCGTCCCCTGGACTTTCTCAAATGACAGGCATTAGTAAATTC
TGAGTTTAAGTAATGGTCACCTGTAAAAGCATATCGCGCTGTTAGAAGCTCTTGTGTAGT
GCCTGCGGGTTAGGTCTCAGACATGCTTTGTGAGTGTCCTTGGCTGTGACTGACTGTGTG
TGTTGTGGGTTTGGGATATTTATTGCCACGTGCCATAATGAGGGGACAGGGCCTTGGCTT
CCAAGGCCAGTGGCTGATCTAGGCGTTTCTTCTGTCTCTTGAGAGACAGTGAGGTCCAGC
AGTCTTATTTGATGGCATTTTTGATCCCCGTATGCAGCGGCAGCTGGTGGTATGGAAGCA
GTCAGGGCTCTTGCTCCTGGCATTGAAGACCTGCCCTTCCTGCCTGGCATTGGTGGTTAC
CTGTGCTCTCTGCCAGAGGAAGATGGCATCTCATTGCTTCCACTCTAAGACTGGTAGTTG
GTGAACAAATTCAGGTGGCTTCCTAGGAGTTATTACCTGACAAGGACAGAATTCCAACAG
GGGTAATTATCCAGCAGTTAGGAGTGTATGCAACAGTGACTCAGTGAGGAAATGTGTATT
GTTTTTAAAAAGCCCACTAGAGATTTCTTTTTTCTCTTTGTGACTAGGAATATGACGAAC
CAATCTTAAAACATCTGCAGGATATTAAAGTGAAATTTTCAGACCCTGGACAACCCATGG
TGAGTACTGGTTGTTTGAACTGGTCGGCATCAGAAACGATCAGGCCACTGAGGGTAAGGG
GTTGGAGCCAGGGCAAGAAATCCACACGTGGCCCCTCACTTGCAGCGTAGACTCAAGCGG
GACACTCACCGAGAATTATGAGGGCTCTCACGTTGCCTTTATGGGCCTCACCCAGCAGTA
TGTGCAGCCTGACAGGTCACTCAGGCCACAGGCTGCTTGGTAGCAGGTGTAGGAGTCAGA
CACAGGATTGGACTCCTCAGCCGTGGTGCCCGCTGCCATGCTGTGCTTTCTGAGCTGGTC
TGTTTCCTCTGTCAGATGGGGTGATATCCTTTTCCTAAGTGTCTCCCAGGTTTATGAGGA
TCTAATGTTTATAAAACAGGTTTAAAAGGATGCTAGGTCTATACTCACGTATGAGCAGCA
CTAACAGAACTCCAAGATACTGATGAAAGAAACCTATGAGGTTTTACCTTAAGAAATAAC
TGCCGGTAGATAAGAGTGGAAAATGTTTCCCTGGTCTTTGATTTGTCACAAAACACCTCT
CTCCAAAATCCTTGCTGTAGTGTGTCATGTTAGGGTTAGCGGGCGGGTCTGCCTGCCAGT
GAGCGAGAGGAGTCTGACCTAAGCCAGCTCCTCTTTGAAGGAGTCTGGGGATGGGGGCAC
GCCATCCTACCTGAGGTGGGGTCCTCGTGGGAGCACTGTTCGTGACCTGTTAGTCTGGCT
GTGGCTTACAGGTTCCATTCCAGTGCTACAGGAGTTCCAACGACACATGACTGACTGACT
GGTGGCTCTCAGCTTCAGGTCTTGGAGACAAAGTGCCTGGAGGACTGTGGGTTAGGTATC
TGGGGGTGGGCATAGGGGCTGGGACCTGGGGTCGATCTCCTCCTCCCCTTGCAGAGCACC
AGCCCCAGCTGGCAGAGGAGGCAGGGGCGAGTGGGATTCTCCCTCCTAGTCCTGCAGGGA
TGCTTGCTGGCGGCCAGGGGCGGGGACACACCTGCATCCGTCCATCCCTTCCACTTTTCC
TGTCTGCTCCGCTCTGGGCTGTGCCATCAGCTCTCCCTCTGCAGGTGGGGGCGTGGGCCC
GAGGCAGAGGGAGGCCTGTGCAGGCTGAGGGCCATGCTGGAGCGGGGGAGCCCTGCTTTC
CTGCTGGGGCTTATCTCAGGGCCTTCCTGCTGCCTGCACCCTGTGCCGAGGCTTTCCCCC
GGCGCCCCCTAGAGGCCCAGTGTGCCGGCGCTTGTTGTGGTTTGTGTGGATTCTCTCCCT
GTGGGGGTGTGTGCACGTGGATGTGTGAGTGCTGTTTTAAGATTTTGTGTGTTTTGTCCT
CTTTCTTCTTTCTCACCTGTGAGTCATCCAGACTCAGCTTACCAAGTTTTCCCCTCTGGA
TCAGTTCCTTTTTTCTTCCTTTGCTTACTGGACGGGTGTTTGATGATTCCTGGGTCTGCT
TCTTCGTTTCTCAGTCCATCTGTCTTGTGTTGTCCTTCTCTTACAGTGGCTCAGAGACAG
GTTGGAGCCCTGGTGTGGTAGACCGTGAGCCAGTCTTCTTTTCCCTTTCTTGTTACTTCT
CCCATTGTAAAAGTCATATGTGCTTACTGTAGAAAACTTAGAAAACACAGAGAAGTGTGA
AGAACACTGTACAAATTTCTGTCTTCTAGAAATGACTGTCAGCAGCTTAAGGAGTTTCCC
CATAGTCTTTGTCCTTTTCAAAATTATTATAAAATATCTAAGGCATTAAAGTTAGAAAGA
AAAACAAAGCCATCGAGCATGAGATTGAAGCACATGGGTGCCATGCCCTCCTCATCTCCG
GATCACTGCTCTTTCTTCTCCAGGCCCGCCACGCCGGCACTGGAGCACAGTGGGGTGACA
GCGCGTGGACAGCGAGACACTGCTCTCTCATGTCACACAGGCTCTGCTGGCATTCCCCAG
ACTTGCCACCACCACCCCATCCTAAATCATTGCATTACGATCAGCACACTTGAACCTAAG
TCTTTTGTTTAAGTTTCTGGTGATTTCCTAGTTTAGATTCCTTTTAGTAATTACTGAGTG
AGAGGAGATGAACTTATAAGGCCCAACGGTGGTTCACTTTGCATTCCTGCTAGCAGTATT
TTTTTTTACTCATTCTTTTTTGTAATAATAATCTTTTTCTGTCTTTCTGTTTTGAAATGA
TTTCAAGGTTAGATCAGAGCTGCAGCAGCAGTGCACAGCATCCAGTGTGTCGTTGGCCTG
GACTTGGCTTGTCCGTGTTGACCACATGGGCGTGTTGGGTGGGGACCACTTCCTAGTCTG
CTCCGCAGGAGGATTGGCAAAGACAGTAGCAGCTGTGTTGACTTTGCTGGGCAGAAGAGA
GGTCTAATTTTACACTTAAGTGCCAGGCGAGTGGGCGTTTATCCAGTGTTTATGGCTGAC
TGGCTGTGGGCGTGTGAATGAGGTCGCCTCATCCTTGGGCCCTTCTCTTTTGGAACGTTA
AGCACTTTCTTTAATTCATTCCCAGTTGTGTTAGGGTTTCTTCTGACTAAACAGAGGCCT
AGGGAGAGAAAAAATAGAACAATATGAAGAAGAGAAATACCACACTTGGTTTCGAGAAAT
GATGTGGGAAGAGAAAGAAGAAAATACATAATCTGTACGAGAGCAGGGAGTGACAAAGGA
ACAAAATGTAAGCGTGCCATTTGCTGCCAGCCGGTCCGCTAGGTTTCCTGTCCTCTTTGT
GATGTCAGCCTTCCACAGTCCTGGGGTAGGAGCATTCTCTCCGCTGACTGCCTCCCTGCC
TTCCCTCCGTGTGTCGGCTTCTGTAAAGCCCTGGGGTGCTGGAGCGGGGTGCAGGCGATG
CCTTCCTATGCTCTCGTGCCCTGTGTGCCGTCCTTTCCTTGCCAGGCTGTGGTTTGTGCT
CGGTGACCACCCCACCAGCCCACACTGCTCTTGCGGAGGTCAGTGGAGACCTCCTGGCCA
GATCGTCTGCCATCCCTTCCAGAAACTGGGCTGTCCCCCTGATCCTCGAGCCACCTGTGT
CTGTACTTCCTAAGCCCTCAGGCCTCTCTCTTCCTTCACTCCTTTGGAGAGTTCTTTTTT
TACTTCCCCTTTGTGGAAGTGGTTTGTTTTTAGTCTTTATTTTTTTTCACAATTGATGAC
TGTACCGTTATAATAAAAATGGAGGGGCCGGCTCCGTGGCCGAGTGGTTGGGTTCGCGCA
CTCCGCTGCGGTGGCCCAGGGTTCCGATCCTGGGCGCGGACATGGCACCGCTTGTCAGGC
CACGTTGAGGCAGCGTCCCACATCCCACAACTAGAAGGACCTGCAACTAGGATATCCAGC
TATGTATCAGGGGGGTTTGGGAAATAAAGCAGGGGAAAAAAAAAAAAAAAAAGATTGGCA
ACTGTTGTTAGTCCAGGTGCCAATCCTTAAAAAAAAAAAAAAAAAATGGAAACAACTAAC
ATTTAGCAACCATTGCCTGTAAACCTGGCCCTGTTCTAAATGCTTCCATGGATTAATCTT
CGTCAACTCACGGAGAGAGAGAGGATCGTCATTTCCATTTTACAGAAGAGGAAAGGAAAG
TGCAGAGACATTGAGTAGCTTCCCCAAATCACACAGCACTTAAGGGCAGAGGAATTTGAA
CCTGGGCTGTCTGAACCCACAGATTGTCTTGTAGACTGTGTCTGTAATAGAGTTTGCTTA
ACCAAGGTTGTCTTTTTCCTTTATCCGTAGGGCTGAGGTGAATGTCTCTGCACGTATGGA
CACATCAATACGTGCATGGGACAAATTCCTCAAAAGAGAATTACTGAGTTAGAGAGTTTT
TGTTTTAACTTTATTAATTTTTTGGTATTGCCAAATTGTCCTTTGTAAGCCTTTTGATAG
TATGTGAGCGCACCTGGCTTTCCAAAACACTCGCAGCACTGCATATTATTCCCTGTACAT
TTTGTCCAAACGGGGGACAGCTCATTTTATTTTTCGTTTATTTTGTTACTTGTGAGCATG
AATCTCTGTCTTGTGATAACAATTTTGTACACACCTGTCCATTTTTCCCGTTGTGAATGT
CTCTCCAGATTTGTAGAGTGCTTTGTGAGTGAAGGATGAACTTGTCCTTTGTGTGGTTTG
CAGAAGCACAGTCAGTGCCCCCCCCCACGCCCCTGGGGTCTCTTCGTGGCAAAGAAAGCA
GTGTTCTACCTGAGTCCAAGAGGAAAGGAGAGGAGGGCAGGGCTCCTGGTGCCTGCTTTC
TCCCTCCAGGCCCCCCAGCCCACATGAGCTCGGGGCAGCAGACAGAAGCTGGGGTTCCTT
GGGAGAGCTTGAGGTCCAGTGGGAAGCAGACGTTAGCGGGCACATGCCCTCACTCGGGGA
CTGAAGGGCCATAGGGGTTTCCCTCAGCCTGGCATTTGTGTTTTCACCTGGTGCTGGTGT
TTTTCTGCAGTAAGAGTGTTTTCTTGTTATGTGCCCATATCTGTTGAGCTTTTGAGTAAG
GCTTTCTGCCTGTGGTGTCCTGCTTAAAGAGGAGCTGGTTTCCAGTAAGTACTGTGTAGT
TCATAAAACTGTCACTAGTTATTTGTTGATTAAAACTGTCACTAGTTATTTGTTGATTTC
AAGTGATGCTAACCCTGAGTTTTTGTTTTTAGTCTTTTGTATTAGAGTTCCACTTTGAAC
CCAACGACTACTTTACCAATTCAGTCCTGACAAAAACGTACAAGATGAAGTCCGAGCCAG
ATAAGGCTGATCCCTTTTCCTTTGAAGGTCCTGAAATAGTTGACTGTGACGGGTAAGGAA
ATGCTATTTTAACTTCTTTTTGCAAGACAAAAGCAGGAGATGATTTTAGAACTTTACAAC
TAAGATAGAAATTAGGAATAAGGCAAAAAGTCTTTAGTTTGCTTGAAAGTTAAGTAGACG
AAGCTTTAAACTAACTGAGTTTTCCCTTTGGTGCTGGGATGGTCAGCACTGGGAAATGTA
TCATATAGTTACACGTGCCAAGGTTTGGGATAGTGGCCCAGTTTCCTCATTTTAATGAGG
GGATTGGGTTCTCTAGTCACCTTAAATGAAGCTGTGATCATCGACTGATAAATTACCCTC
AGCAAGTATTTGTTGAGTGAATGAATGAGTCAGTGCAGGGCAGTTTTGATTAGTTGCTTG
CCTTGGAAATTGGTGGCCCAGTTCGATTGGTTGAATCATGACGGAGCACCTTGGGGATTT
CAGTCTGTAGAGCACCAGAGAGAATGTGGTTTGGAGTTCATTCCTCTTGGTTTGTTTGAG
ACCGTTTGAGAAATTGTTTTATCCTTGAATTGAAACAATTATCCCTCTTCACTGGAACCA
AGTACTAATGCTTATGAATCTCCCCGTATGAGTAATTTTATTAAGATCCTGTTAGACTCA
AATGGCTAGAGTAATTTAGAAAGATCATTTCCCAGAGCCAGGCCATCATGGGAGAAGAAA
ACCTAGCTTTCCAGGCATGCTCTTGAGCAGACGCTCGTCAGATCCTGCCACGTGTTACCT
GTTGTTCCAAGGTGATTCAAAGAGTTGTTCCAAGGTGATTCAAAGAGTTCAAAAGTGCTC
CACTCCCACCAAGGGCTGCTCCAGCACCAAGGACCTGCATTTGGTGTGTTTTGCGTTAGG
CATCAGTGTTTGGAGTGGTCACCTGTTTCCTTTCCCCAACTTGTCCCGCTCACTTAGTTG
CCTTGAGAATTTGGGTGCATGAGTGGGTGACTTCATTTGTGCTCTGGAGTCTGAACAGGG
GCAGCAGGTGACAGGCTCTTGAGCATCAATAGGCACCTTTGCCCAACCTTGACTGGGCTT
GGTCACAGAAAACACGTTGGTGAGTCCTTGCGACGTAATGCCATTGCAGTTCGAGAAGTC
TAAAACTTAAGACAGTGTCCCACCCAGGATGATGGCGGCCACACCGTTTCTCTTTCACTG
ACCTTCAGGTGAACCTCATGGTGTGTGTAGTGCTTGCTTGCAGGTTGGTTTTATTAAATT
TTCCAGGTTAAGCGTGGAGCTGTGGTTTGCTTACCGTGTCCACCTGTAATGACTGTTCTC
GTGGAGTGTGTATCGGTGACTCCTGTCCTGTCCCTGTAGGTGTACTATTGACTGGAAGAA
AGGGAAAAACGTCACAGTCAAAACAATCAAGAAGAAGCAGAAGCACAAGGGTCGAGGCAC
TGTTCGGACAATCACCAAACAAGTCCCCAATGATTCCTTCTTTAACTTCTTCAGTCCGCT
GAAAGGTGAGCGGGTGAGGCTGTGAATGTTGACCATGTACTTATATAAGGTACCTTTGTT
GGCCTCACAGGGTCCTGGTCCTCTGGTGAGCGTGGGAGGTAAGGGGATGGTGGCCGTGCC
TGAGGCCGCTGTGCTCCCTGGGCGCACGGGGAGCAGGATGGGAAGCCCAGGCGAGCTCTC
TGGGCTCTCTGAGAAGGCGGAAGCAAGTGCCCGCGCCTGGATGACTGGAGCACCCAGCGG
CCGTTCCACGCCTTGCTCTCGTGCTTTCTGCTGTCCCTGGGGCGGCCCCCAGCCTGGAGC
TGTGGACTTGGCTCTCGAGGCACATGTCCCTGGCTGTGCTCTGGTTACCCTTGACCAGCT
TTTGAATTATCTGCCCACCTCTCTCTTTCTCATAAATTGTTTTGTTTCGTTTTTCTGCAT
GACTTGGTAGAGCACAGGGATTTTGGAATTTATATGTTGTGACAAATGTGAGTACCGTCC
TGTGCCATGCCACAGTGTTTTGGTGTACGAGGGCCCACATAGCTGATGGTGATCCCATAA
GATTAGCACCATGCAGCCTAGTTGTATAGTAGGCTCTACCTTCTAGGTCGGTGTAAGTAC
ACACTACGTTTGCACAACAAAGTCGCCTAAGGACACATTTCTCAGAACGTGTCCCTGTTG
ACACGTGACTATAGTTGGTTTTCCATTTTTGAAAGACTTAGGGCAGAATCATAGCTTGGA
AGCTTTTTGTTTCTTTTGTTTTTTCCTTCCCTAAGTCATAAAGATGGAACCTTTGAGCTA
ATAAAGGCTGAGCAACTGGTTTTGAGAATAAATAACTTGGAAGTCTTAATATAATTTTCT
AATCCTGAGAGAATGTGAAGGCCAGACCACTTGGCAATGTTAAAGTGTGGATATGAGGAA
AAACCATTTTCTCTTTATTTGTAATGAACAAAAACAGTTTGAGATACAGAAACGCCGGCT
TCTGCTCCAGGGAGCCGTGACCCGGCGTTTGCCTGGGGGCCGCAGGGCGGCTCTCCCCTC
AAGTCTGAGCCCTGGCCTTCTGCCCTGTCTCTGAGCCAGTGCCGTCACTGACCTGCCCCT
GCCACTCAGTCCTTCACTTTTTTTATTGGAGTGGCCATTTTCTGCAGTTTGTTTTTGAAC
CTGGAAGATGCAAATGTATATTAGTTTGGGGGTTAAGAACAGCCCAAAATTTAGTTCCTA
AATTTCCTTTTTCGGAAAGATCCCTTTTGGAGCCTTGCATGGGCTTATTGGAGGGTACCT
GTCTGAATTCAGCGTGAAGCAGCGGGGCCTTGATTCTTAAAGTCAGTGGCTTTGTTGGAA
GTTTTTTAAAACTGGATTTTAAATAATAATATTAAAATAGAATTAAGTGAATTCCAGAAT
TTGGGGCATGATTTGGGAGATTCTAAAAATGCATTGGGATGGTTGCACAACTCTAAAGGT
GTACCGTAAGTCATTGAATTGTACACTTACAGTAGGTGAGTGTTACGCTCTGTAAGTTAC
ACCTCCGTGGAGCTGTGTTTAAAGTCGTCAGACACACAGAGCAAGTGATAAGCTCCATGA
AAGCGAACAGAGGGTGGTAGGGGCAGGGTGATGGGATTTGAGTCATTTGATCGTTTTAAC
GTCGCCAGGCTTTGTTGAGCCTGGTTTAAGTCCCTGTCTTTCCTGTCACACTTAGTTTAG
TGTCGGGCTCTAGTCCCTCAACAAAATGTGTGGTCGTATGTGTGTTGAAAAGTGCAGAAC
ATCGGTGAATAGCACCTCCTGCCCCCAGGGGACTTTTTTCATTTTGCAGGAAGAATGTTT
CAGCACTCTCTTCTCTCCTCTCACCTTTCCAAACAAACAGAAATGTGGTTTTGACCTAGC
TGAGACTCAGTGTCTTGGGAACACTCAGGACTTACGAGGCTTAAAGATTTTCCTCTTTCT
CCACGGAATCATCACATTGAGTTTTGTGCAGGACACGAGTTAAATCTCCACTTCAGCACA
AATGCCCTGAATGCCTCCAGTCAAGGGCCACCCCATCCACCTTTCGCCCTGTTCATGCCT
CTGGCTTCTCTCAGTGCTTCTCTGAATGTTGCCGTTCTCCAGCTGGCTCCCTGGGCGAGC
TTGGGTCCCAGCCATGGCGTGAGGGAGTGGGGGCGGCAGGGCTGTGGGCACTGGAGCTGG
CGTCGTTAGGCAGGGGTGGTGAGGGTGTCCAGGAGGAGGCACAGGTTTAGGCAATTTCTG
GTGACAGCTCGAGTTGTGAAATGCTCCATTTTATCTGTCAGCTGAGCTTTCTGTGTGGGC
TTTAAAAGGTTGTGGACATGAGTGTAATGTAGAGATGTTTTTTCTTTTCTTCTAGCATCT
GGGGACGGAGAATCACTGGTAAGATCTGTGTTGTCATCAAAAGTCTTGTTTTGCCGTTAA
ATCTGTATTTCCTGAGTAGTTGCCTACTTTCTTTTTAATTCATTCCTACTCCCTGAAAAC
CTGGGATTAGTTTGTGGGCTACGGTGTGGGTGGGCTGAGGTACCTATTGCACTGGGGCTT
CAGGGGCAGAGTGGCTTTAGTCCCGCCCACCTTGCACCCCTGGCGCTCCATGGAGCCCGG
TGGCCTGCACTTCCTACCTTCCCCGCCACCTCGTGCTGGTGCTTCCTTCAAAGCCGTTTA
GCCTCATAAAAGGCTGTCGCCCAGCAGTGCTGGCGTTGGTGCTTTGAGTCACCCGAATTG
AGAGACAAGGAGGAGGTGAGAGAATGTGATGGTCATCCCATTGAAATGAGTTAACATCTA
GGTTTTCCCTCTCAGGATGAAGATTCCGAATTCACGTTAGCCTCCGACTTTGAAATTGGA
CACTTCTTCCGTGAGCGGATAGTCCCGCGGGCTGTGCTCTACTTCACGGGGGAGGCCATA
GAGGATGACGACAATGTATGTGGCTTGGGGGCAGCCGCCCCCTGGGTGCTTACCTCTGCT
GGTATAGAGAAGTCCTGAGTGGTGGCTGGGAATTCCCAGGCCAAGATTTTTATTACGTCC
TCCACCAGATACATGGTACACAGCTCACTGGCATTTGGGGGACATAGACTAGGAGGAGGA
GAAATGGCAGAAACAGAAGCAGGAGCAGCAGGTCGCTCTGAGGTGGTCTCAGGGCAGGTG
CCAGTCCCCTGTGTCAGCCCCATCCAGTGACTCACTTCGTAATCTCCTCTAAAGACCCCA
GGGGTTTACTGTCCCGTTTAAGGTCTGTAAGCTTTGGGTGACTCGTAAGCACGAGGAAAA
TCTCATTCACAGAGGTCTGGCCACACCAAACGATTATCATCAGAGCCAACTTTGTGCCTG
CCTTGGTGTGTCAACCCCAGAGAAGTAGAAACTCATGCTCCACAGAGAAAAGGCGCCACT
GTGCCGGCCACTTCTCTCTGCTTGAAGGAAACAAGCCCTTGCAGTCAGCACTTGGGAGCA
TAACCCCTGGGCACAGCTTACCTGGCCGTTCTTTGACTGTCACCTGGGACAGTTATCGTA
ACCAAGGCTTGGGTGGGGAAATAGAGTCTGTCTTGTAGCATGCTACTGGAAGTACGGTTT
AGATGGTATTCCCTTGCTTTTAGCACTCTTAGGTTTCCTGGATGCTTCTAGGTTTCCTTT
CGGATGAGGTCTAGTAGGGCTGGGGACAGGGCCATAGGAACTGGGCAGCTCTCTGAGGCC
AGGAAGGCCTGCTTCTTGCACCTCCGCATCGTGCTGAAGGTCCCGAGTCGGGGGCGGGGG
CCAGACCAGGGCGTGCGAGCCATGTGGTGTGGACCAATTAATCTCTAAAGTGCGGTTTGT
CCATCCCTAGACTAGGAGATGGCCTTGGGGATCAGGAACCGTGTACACACAACTCAGCAT
GGTGTGGGGTCATTTAAGCACTCAAGTGGTTGTAAGACTGAAGTTTTAGGAAATGCTGGT
TACACCACAAATTCCAGACCAGCACTGTCCAGTAGAACTCTCAGTGGTGATGGAACTGTC
CTCTGCCTCCACTTTCCAGTGCGGGAGGGCTGACCCTAACGCCACTTGAAGATTTAAAAT
GAGACTGTTGGCAATTAGGAAACTGAATCTTTAGTCTCATTTACTTTAGCCAAAACATTG
AAAAGCTCATCTCTAGGCCAGTTGTCTCCAATCTTTTTTGATCCTATACTGATCAATTTA
AAAACTTGAATATGCAGCCTATGCATATTTATTTACTTAGAATATATGCACGTGTTACTA
CAGGTGAGCAGTTCAGTGGCTTTGCTTATAATATATGTATGCACATTCGCTCTTAATACC
TTCCATGCTCATACTGCTGGTGAGCAGTGCAGTTAGAGGACAGCAGTGGGAGCTCACGTC
AGACTGGAGTCCTGACTGCCACTTACCAGGTGTCGCCTCCGTGCTGCAGTTTCCTCCTCT
GTGAAACAGTTAATGTGCACAACTCGAGTGACTTGCCAAGCTCTTGGAACAGTGCCTGGC
AGAGTAATTATTCAGTAAGTGTTGGTGTAAAGATTGGTGTAGTGGTGTTGGGTGCATTAG
ACACTGTGCGTGAACACTGGACGTTGTCCAGGATGCCTGGGTTTAGGGTTCTGGTTTCAT
CTTCCATGCTCTCCTGGGTCATCTTGCTCAGCCTGAGGGCTGCACACCCCATGTTGGAAC
CACTGCTCTATGTGAGTGTGATGCATTTGAAACAGGAACTTGCTGCCCCACAGAGCTCTC
TTGAAAGACATGGGCAGGGTGAACTGGTGTCCTTGGAACCTCAGAGATCGGCACTTGAGC
CTGTTTGGGGCTGGTTGCAGTCTGACCTGAGATGCTGTGAGAGTCTCATTGATCACAACA
CTGTGAGGTCTTTCCCTGTCAGGCTGTTGCAAACTCGGAAGCAAAGAGGGCCAGGAGGCA
GTCGTCCTGTGGGGGTTCTGCTCAGTGCCGGAGGGCTGCTCACTGGCCTGGGGTCTGAGA
CGGGCCACGCAGCACTCAGCACTCTTCACGTCCCGCTGAGTGGTCTCTGAGGAACATGTT
TGTGGGCTCCAAAAGAGAAATGTTTGTAAGAAAAAGCCCAGTGACTCTTCCCGTACCCTG
TGTTGTGCACCGATAGTGATGAGGTTTACTTTGTTTTATATTCTGATGCCAGTCTGATGT
TTGGAACTTGAGTGAGAGCCTGACCAGTGATGTCTTTGGACACAGGAGAAATTTATTCAA
GAGCCACCAACTGTAGCATTGGAGTTTCTCCCTCGCACACTTTAGTTCTGACTTATTTTA
AAGGTTAAACACCACGATTTTATGATATTTCTCGTAAATGTTTCACCTTGTATGAGACAT
AAAATGATATCTCAATTCCTGTATGTGATAAAATGATGCTACTGGTTTGCTTAGATCAAC
CAGTTTCCCAGGTGGAGCCAGTGCGCACACAAGCCAGCCGTCTCCTTTCTGCACCCCTCT
GCATCCTCAGTCCTTGTTTTGGGTGGTTTTTAGGTACCTGGCAGCCTATCAACACAGCAG
GGCTGGGGAACAAGTGGCCCTGCAGTGCTGGCCCCGGCTCAGTCTGCAGTGTCAGTGCCC
AGAGATACCCAGTGGCAGACTGTCCCTAGGAGCTCAACCTGGAGCAGGTGCTGCCGCTAC
TCAGAGGCCGAGCCAGACTTCCTGCTTTCCTTGAGCTTGACTGTGGGCACTGGGCAGGGA
CTGTCTGGGTCAGGTGGCTGTCATGTTTTATAACCTGAAAACGTCTTTCCTTGTTTTTCA
GTTTGAAGAAGGTGAGGAAGGAGAAGAGGAGGTAAGACTCAGCTCTCTGAAGCATCGCCG
CTTCTGTGAGGCTGCGCCATGCCTCGTCTGCTTGAGTGGACAGAGGTTCTGAAACTATGG
GACCAGGTTGGACCCATTTTGTGAGACGCTGCCTTTGAGGCTTTTAACCTCCCTGAAAAC
TAGGGAAAAGCGTGGCAGATGCTGTCCAGCGTCCAGTTTTTGACCCTGCAGTTGGTTTAT
GAAAATGCATCTTAGAAAATAACCATTTAACAGACAAAATCTACGTTTTCAGCAGTGTGT
TTATTTCAGGGTGATCTGTGAGAGCAAAAAGATACCCAGAAATAATTATGTGTCCAAAAG
AGGTGATTTAATCAGTTATGGATAGTAGTAATTGGTTTCCTTCTAAACCCAAGTATTGCT
TTAATTTGTTTGTGGCTGGTGGATCCACAAGAATATACATCTTGTCTGTTCAACTAGTTC
TCACTCCTTTTAACAGGAATTAGAAGGTGACGAGGAGGGAGACGATGAGGACGATGCTGA
GATTAACCCCAAGGTCAGTTATTTGGGGGCTGCCTGAATCGGGGCTGCACGGTTTAACTT
CTCAGATGTGTTTCCCACTGTGAGGCAGGAGTGTTAGGTTGTGTGTTTGTCATTCTCTAA
TTAGGAAACTTAAAACCTGTCAGAGAAATACTTGAATGAGAAGCTATTAAACACCTTATA
TGTGATTTGAGTGTTAAGTATATTCAGTACAACGCTTTTACAGCTCTTTCTCAAGCTATA
TCTTATTTACATAAATTCATTCAGTAGATCAACATTATTTTCCAGATCTTTAATTCTTCT
AAGATAATGATTTAACTGACAACATGAATAAACTGTTTATTTTGGAAAAGATACAAAGAA
GGAACTTTTGAAAGGTTGTTTTTTTAATGACTAGAATAATGGAATTCTAGGCATAATTTT
ACAGTTGTACATGGGCCAAGAATACTCAGATGTCTAGATAGCTCAGATAATTTAAGATAA
AGTAGGAAGCTTTGCGAAAAAGAAAAAGAAACGGGCAATTTCATTAATTTTACCTGCGTG
TCTGGATTTTTTCCTTATCTCAGATTAGCTTAAATCAAGGTACTTTGTTACTTGACACAT
AATTTAATGTACAGCTCACTGCATCCTAGAATTAGATACACCATGACTGTCAGAGGACTA
ACACTCCTGGTTTATAATGTATATCTCTATTTAACATCATGTTGTTTGTTTTTCTCCTGT
TTTTGCCCAAAGTGGAATGTGCACTAAGCTGTCTGTAATAACTAGTTCTCTAATCCATGT
ATTAACACCAAATCTTTCTGTAAATGCATGCTCACAGTAGCAGTTCCTTCTAGGGAAAGA
TGGGAGATGGTTTAAAACTTTTTTCAATGTGCCATATAAATACCACTGTGAGAATTAGCT
CATGGAAATGTTCATTTTGTCACAGTTGGCCTGTCCGTCAGAGGATAACTGTTGAAAGCA
CACCTGTGTTCGGTGACAAGCAGCCAGAGGCCGAGAGGAGGGACGGGAAACCGGGGACCC
AGCCTTGAGTGGATCAGACTTGGTGGGCAGGGGGTGAGGGATGTCCGTTAGTTAGCAGAA
CTGGGCGATGATCACCCCCAACACTGCTGTGCGCTGGTCCCAGCTGTAATATATGGCTGT
TTTTCTGCCCTTTGGGGTGCTGCTGCACACATTCCCGGTTTGGATTCTAGAACAGAGGCT
GAGGATAGTTTGCAGGTCCACCTCCAGACTCAGGTGCACTGTCTGTCTTGCGTTACTGGC
AGCTGGTGGTCCGTTCCTCCGTTTCTTGTTTCCTTCTGTCCTCTGTCCTCCTCCTCTTCT
CTTTCCTTGCCAACCTTGTGTCCTCTCACGTCTTGGTTTTCTAGAAGAGCATTCTCACCA
AATGATCACAAATAACTAGAAAGGAAGTGGAGGGTCCTCAGTACTCATTCTTCATGGAGC
CTGCCAGTGGGCCATTGGTGGGAGTAGGTGAGAAGTGATGACAAGTGAGCAGGGTCAGCG
GTGTGATGTGCTGTTTCACACATGCAGTTGGAACGACTTGAGTCTTGTCCTCTGGGCTCA
GGATGTGACACTTCTGTTCCTTCATATGCACCTCTTCAGAGGGATTTGTCACGTTAGAGT
CTGTAACAAGCAAAGGAAGATAAGGAAGAAACAATGTTTTGGTATTACAGGTACAGAACT
GGTGGTTGAGGTTGCTTATCTCAAGGCTGATATTTTGCAGCTTTTTGTATCATGAGAAAT
TGTGGCTCTTTCCTCCTATGTAATTTTGTGTATTTCATTTTCTTTCATGCTGACAGTTCC
TCTCCATTTTTTTCCCCATTTAGGTGTAATTTTTGTCTGTTAATCATTCATGCGTTTCTA
GGTAAGGTGGAATTCCGTTTATTCCTAACTTCCAAACTTCTGATCTGTGCTTGTACAATG
CCTTGCTGTGACTTTCTGGATGCGGAGGAAGTTGCTGTCCAGGCTCACTCGGTGTGTGCT
GGGCTGGACCCAGTGTTTCCTGGAGAGCAGTGTTTCTGTGCAGGTGTCTGTTGAGTGTAC
TTTAAAACCAACTGACAGGAACTACTTTTGGCTCCTCTTGCCGAGTACAGTGTTTCTGCT
GACCAAGCAGCATGATGTCACTGGTGTGGCGTTTTTATTGACAGTGGGATTGCCCTCCTG
GAACAGGACGGAATGAGAGAGCCCGGGAGGTCGGCAGCCTGCAGGGTAGCACACGTCAGC
CAGGGATGCTGTGCTGGGATCAGCCACTCACTGTGGCAGTAGGAATCGGTCCACTGTGGT
TTGTCTTGACGTGTGTCTGTTGATTGTCTGTACTTTTCAAGTTCAGGTGTTGTGCAGACC
AATAGGTAAAAAGGGGGTGACCACTTTGAATGTGCCAGAATTTTTCTTCTAAAAAGCTGC
TGGCATCTTTTTCATGTAAGCATTAACACATGCTCTTGAGGTTGCTGAAGAGTGTTCTGG
CTGAAGAAGAAAAGAACTGGTTGTAGATTTAAGGAGCGTCAGCAACCCCCAGGAGCCGCC
CCTTCCCCACCATGTGGCTTACCCTGGCTCTGCTCCAGTCATGAAGTCCCTCACTCAAGG
GATGCTGTCGTCACCTCTGCGGGGTGCTGGGGGGTGGTGGGGGAAAGGAGAGGTGGGAAC
AGGAGATGCTGTGAGAAACAAGTGCAGTAACAGTAACATCCGGGAAATAGCAGGGGTTCG
ACATGTTGTGGTAAGGAAGCAACCGGTTTAAGAGCAGAGCCTGTCAGAGTCGGAACTTTA
GAACTTCACCTGACCGCTGCAGATGGTCCATGGATGCAGGCAGTCAGTTAGACCTGAGGG
CTTTGAGCGTCTGTCTGCATTGCCTTCCTGTCTTCCTCCCGTGGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1926..1984, 4223..4322, 7332..7473, 7705..7791, 9380..9511, 12707..12778, 17372..17511, 18819..18964, 21295..21317, 21735..21854, 24661..24690, 25156..25212, 27023..27066
1020..1033, 1926..1984, 4223..4322, 7332..7473, 7705..7791, 9380..9511, 12707..12778, 17372..17511, 18819..18964, 21295..21317, 21735..21854, 24661..24690, 25156..25212, 27023..27025
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved