Equus_caballus Locus TCP1
snOPY snoRNA Orthological Gene Database
Equus_caballus TCP1
Equus_caballus
TCP1
31
SNORA29, SNORA20
4001..4138, 9018..9147
11556
GAGCATCGGCGCCGCGACCAGGGACGAACAAGCCCCCTGCCGCTGAGTGGCTGAGAGGG
CAATCTGTTACCTCCGCTCCTCCAATCACCGCTTACGCTGGGGGCACGCAGACGCTGGGG
GCAACCAATCAACTCGCAGTAACGCACTTGCGGGTGGGGCGCGACCCGTTAGTTTGAGCA
GCGGCCTTCCCGGAGTTCGGCATGTAAGATGCTCGTTAACTTCCCTTTACGATTGTTTTT
GGGCCATCTGGTCACAAAGCCTAGACCGACCATTGTCGGGCCCACGCACACCCCAGATGG
GCACTGGGAGGAAACGGGGCAGCGCACGATGCACAGTTTTCAGACACGCCGGTTGTCTTC
CCGTATGGCCCGTGGGAAACCCTGGCGTGTCCCACCCCGGTTGAGGCCTCAAGTTTATAC
TCGAGAGCCCAGAACAGAGCCTGCGACTTGCCGCGCGCTCTCCACCAAGCTGCGACATTG
AAGGAGAACAAGGAGAACCCGACCACGCTAGACTCAGAGGCTCAGCTCAACCTGAGAGAA
GGGCCCGCCCCCTCCTGTCACACCCCAACTCCAAGCCCCGCCCTACCCACCACCTTTTCT
AGAAGGCACTAGAATGCGCAAAGGCGCACGCGCAACCCATGCCTGGGGAGAAGCCTCAGC
CCAGTGCCTCCTTCCCGCAGCGGCCCCAGATCCTGACTTCCGTTCTCCTCCCTTCGCGCC
CTCCTCATCCGCTCTCTTATTGGGCGAAAGTGCTGGACCCGCCCTCTTCCGGCTGCTGAC
TTCCTGCCCACTCTCACTTCTCACCCCGCCCCCTGTCCTTTCTTTCCCGTCCTGCCCTGC
GGCGGGCCCGGGGAGTGGGAGCCGTGTTCCCAGCAGTCCCCGCGGCGTCGCTCGGGCCCG
TTCCACGCTGCCGCCGCTGCCGCCGCTGCCACCGCCGCCCGGCCTCGGGACCGATCCGCT
CGTTGCCTGCGGTGTGAGCGAAGCTCGACGTGTGCCCTGCCGCGAAGATGGAGGGGCCGC
TGTCCGTGTTTGGGGACCGCAGCACCGGGGAGGCCATCCGCTCCCAGAACGGTAAGGGCG
GGCGAGGCCTGAGTGGGCCGGCGGCGGTGTGGGCCCCCAGCCCGCCCTGCTGGGCCTGTG
GCTGCCGGGCTTTCAGTTTCCTTCTCTTTCCTCAAAAAGGCCTCCTCCCGGGGCGGGGGC
TCTCCGACCCCCGCCGGTCTGGCCACCTCGAGGGGGCGCGGCGGCCCGTAGGGGAGGGAT
GCCCGGGGCGCTCCACGTTTGGGGAGCTGCGCGGGTGGCGGGGTCGGCCGTGCAGGTCCA
GGCGCTGGTGTGGGAAGAGCGCTTCCGGCCTGGAGAGCGAGTCCCGCGCCCCGGCACGTG
CCGGCCACGCCGGGAGGCCCCCGCGGTCCGGTGCCTGTGCCCCTTCTGTTCCCCTTCTAA
GCGGGTGGAGCGCGTGTCCCGGCCACGGGGCCTCGTTCTAGGGCCATTCACCGGAAAAGG
CTGGGTTCAACTGCTCGTTTCACTGGTGGGCAAATGGCCGCCAAGAGATGACTTGCCCGT
TGTCCGCCTTCCACTCACCCCCGCCCTCCCCCGGGATCATCTGCAGTGGATGCGGGTCCA
CATCCAGTTCTCACCCCACTTGTCGCTGGCAGCTTTTTGTACTTAGCTGCCAAGATTTTA
GTTGCATGTTAGCATGAGCGGTGCTTGAGATGGATTTGTCGACGTAAACCTTAATACGAA
CTAAGGCATTTGTGGTGGTTGAGCCTCTCGAGAGCGTTTACCCGTTGAAGTCATGGATGC
CTGTCGATCTTACCGTTGTTTGATAGGTTCTTAATTTTTGTCTTGGGCGAATTTGAAGTA
AGTTAGAACCTTTGGATGGCCGATTTTTTGGTTCACAAAGACCATATTGATTTTAACAGT
ATAAAGGAAATAACTGTCAAAATCTGAAGGGAAAGGCTGATATGGATCTTTTTTCTTTTG
CGTGGAGGAGTAGCTGGACCCGGAATTATAACCAGTAGATGACTTTTATTCTATGGGGCA
ATGAAGTGGGATACTTTTATATTAAAACACTTGGCATCCCATTTTAGATGAATTCCAACG
GAATTTTGCTAGTCTTCCCCTACCCGTATTGGACTTTTCAGTAGGTAATTTTTAAGTAAT
TAGGGTAGACTTGTAGATTTGGAAAACTCACAAGCTGTTGGATGTCGTTTACTTTCTTTA
GGCCAAAACGGTGGCCTTTTGGAGTAGTGGATTTTTCTAATTTCATTTCTTTTTTTATTT
GTACAGTTATGGCTGCAGCTTCTATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTG
GCTTGGATAAAATGTTGGTGGATGATATTGGTGTAAGTACACCTAGATGTTTGTTACTTT
AAAGAAAAAAGGTAGTTTTAAAAATATTTTACTGTCAGATTATTTGTTTTTGTCAGAATG
CTGGTGTGGGAAAGTGTAGTAGAAATGAATCTGTATCGTAATGGGGCTGTGTTAATGTAG
AGGCTGTCTTGTTTTTCCAGGTGACTGTTGTCTTTCTTTCCTCCTCTGCAAATTTTTTAG
GATGTAACCATTACTAATGATGGTGCAACCATCCTGAAGTTGCTGGAGGTAGAGCATCCT
GCAGCTAAAGTTCTTTGTGAGCTAGCTGACCTGCAAGACAAAGAAGTGGGAGATGGAACT
ACCTCCGTGGTAGGTAGTCACCGAGTGGGAGAGGGTAAAGCCTAGTGGTTGTCCTAGAAT
TGAACTTTCAGAAAGGGAAACTGAAGTCAGTCCTTTGCTTCTGTGTCAGAAATAAGTTCC
ATCCTTGAGAGGCAGGAAATTTAAGTTGTTGCTTGGGTAATGATTCAGAAACAAAACTTG
AAAGGTGATGGTTATAGCTAGGTTGCACAAGTTAGGTAAAAAAAATAAAATTAAGAGAGA
ATAGTTCCCTCATTTTAAATGTTGATTTTCACAAGTTTTATGAGTTTTTTCCCCCCTCAG
CTATGACAATATTCATAGATCACACAAAGGTTTTTTTTTTTTTAATAGTCTCTTTTTTAT
GTTTTGTTTTCTCATCCCCCTTTATGACCTGAGGCCTGGAAATTTCTAAAGCCTTGTGTT
TATAATTATCTAGAGAAAAAAATGTTACCAGTTTTTTTAAAAAAAAAACAAAGGTGTTTT
TATATTTTAAATGCTGACAGGCAGTCTCATGCGTTCAGAATGGGATTGCGAGAAAGTCAG
TGAACATGGGATCAATAGCACGATATAAACTCTTTAAAGATCATCCGTAACACCGATGTA
GTAGAAGCACTGTTATTTGGTAAAGAACACATAATTTGCTCTAAAGAAACAAGCAGTGGT
TTGTGGGGAAAATATTTTTTAGTGTCCTTAGGAGGATGATTTTTTTAAATAAACCAAGTA
ATAACTTAAAATAGTACAGGTCTTTGAGTACTCAGACTTTTCATTGAGCTTCTCTTGAGC
GTTTAATCTTTAAAGGTGGTGGATGTGTAGTCGTCTGTTGTACCGCAGAACTGGCTTTAT
TAGAGCATTTTTTTGGCTCCATCTAGTTTTGGCCATTTGTGTGTAAAACTGCAAAGAGTT
TCCTTTTTTTGTTTTCTGATAACCAGTTATTCGTTTCACCACCGTCACCGTTCTGGTTAA
TAACATCTGAATCATTTTAGTATTCTTACATATGCGTTGCACATGTTGAATGTCAGAGTA
ACATTAGAGCAATGGATGTTTTCTCCACAGGTTATTATTGCAGCAGAACTTCTAAAAAAT
GCCGATGAACTCGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTT
GCTTGCAAGTAAGATTCTTTGCATTCAGCGAGAATTTTATATTATTTGATATCAACAGTG
TGTTCTTTAAATGTTTTGATTAATGACTAAATTTTGTTTTGAAAGAGTGTGTTTTATCAC
TCAGGTAGTAATATTTGAAGTAAGTGGGACCAGTATCCTTTTTTCCCAGTTGACTACCAC
ATTTTCTCCTAAATAGATTTTAGTGGCTATGCTTATGGGATAGACTAAAATTGCCATGAT
CTGAAGAGGGAGGATTTGTTTGTGTCCTCCTCCTATATGAAATGGCTGGACAAAGTTGGT
GCCTGTGACATTTTGACACTGACTTAAGAAAAGTTTGAGTAGTGGATTTTTAAGTGTTTT
CTCTCCCACATGTTAAACAGGGAAGCAGTGCGTTATATCAGTGAGAATCTAATTATTAAC
ACAGATGAACTTGGAAGAGATTGCCTCATTAATGCTGCTAAGACGTCGATGTCTTCCAAA
ATCATTGGAATGTATCCTTGTGATGGTCCGGTCAAGTTTAGGCTATAAAGTTAGGGGAAG
GGTGATATAAAGTGTGGGTAAAAGTCATATGTGTTATAAATAGTGATAAATAGGACTCTA
GCATTTTGATGGTGTAAATAATGCTAGTTTCTTTGATGAGATTGCTAAGAGGAACTGCCT
TTGAATTAACCTTGATTTTCATGTGCATCCATTGTCCAAGTTTCTTGTTCTCCTTAACTG
TTGGCTTAGAAATGGTGATTTCTTCGCTAATATGGTAGTAGATGCTGTGCTTGCTATTAA
ATACACAGATATAAGAGGCCAGCCTCGCTATCCAGTCAATTCTATTAACGTCCTGAAAGC
CCATGGGAGGAGTCAGATGGAGAGTATGCTCGTCAATGGCTATGCGCTCAACTGTGTGGT
GGGAGCCCAGGGTAAGGTTTGGGATTGGGTCGCGTAACAGGAGTACGAAAGGGTAAAATT
TGCTCTCTGTGGACTGCATACTGTACATCTTCAGATGAAGTATTCAAGACGTGTGCCTGC
TGTTCTTTAATGAAGCCCAGGGGGGAAAGGAAATTGTTTATTGCGTTGTCAGTTTCTCTT
TTGTAGCTTAAGTGCATATAACTTAGGAAAAATGCAAGTTAAAAGAAAGTACATGCGTTT
AATGCCATAAAAATTTGTTTCTAAGGTTAAAAGTAAAATCTAAATTTGTATATTTACATA
TTACATGGTTTTTCTGTGCTATTTATTATGTTTGAGTTGTTTTATAAAATGTAGTCTTAT
AGTTACTGTAAAGGAACTTAATATTATGTTTAATTATAGGCATGCCCAAGAGAATAGTTA
ATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAGAAAACAAAAATGAAGCTTGGTGTAC
AGGTGGTTATTACAGACCCTGAAAAACTGGACCAGATTAGACAGAGGTATGTTGAGAGAT
TATTTTTGGCCTTTGAAAGGGGTGTTTGTAAATCACCCTTCTGTTAGAACAGGTGATAGT
TAACTGGAAAGAATGAGTGCTATATTTCATAGATGATGGCAGGTAACCAACCAGTCACTA
GGTGGCAGAGTATGGCGATTATGCAACTGGGTTTTTTTAAGTGTGAATGTCTTGGAGGAT
TTTAAAAATTCACGTTTTTAACCAAACTATTTTCCATAAATTTCCAGGAAAATTAGAAAA
TGTGATGGTGTTTAAAGAGATTTGGAGTGATAGAACTTACATGAAAATTGGGCTTTTTGT
GGAATTTTGGTTTTATGGGTGGATTGATATTACAGATAGATCCAGGAATGTGCTTCCTCC
TATAAGCCTTACAGGAACCCAGCAGTGCAGTGTTGACTGACACCTGCTGCCCGCCAGGTC
CTAGGGGCACAGACGGTGCGATTCATTGGTTGGCACGCCAGAGAGCTGGTGTGCACTCGG
TCGGCTACCGCTCTGCACTTTGCCTAACACTTGACCCGTACCATTCAAATAGCTTTTTAA
ATGGTTAGTTGGTTAGTTTAAAAAAATGAACAGTGACTGAACTAAATCTACGGGAAGTCT
TTGCCAAGAGTCAGGAATGTTGTCATCTTTTAAATCTATCTGTATGTGTATACTTTCCTT
CCCTCCTTCCTGATGTAACAAAGTGTCCTTCCAACAAAGGCCCGTCCCTCTAGAATAAGT
GTTCCCAATCCTCTTGCCTCCTGCCTTGAAGTCTTGTTTCATGGATTGTTCTTTCTCAGC
TTCTCAAGTGCATCTTCAGCTACTAATTCTCCTCTTCATTCCTTTCTAGTTTCCACTTGT
AGCTCTCTTATCTTTCAGTAGAAGCCTCTTGCTCACATATCCTGCTCCAGTTACTCTGCG
TCCTTCTCCAACTCTTATAGCCAGGTGTCCCGAGTGATTTACACAAAAACTTCCCTGGTG
CTTTACTTTTTCTTCTTATCCTCTTTTCTGTTCTGCTCTCCAATGGAAGGTCACTTGTTA
AGGTCACTTGTGACCGCTTAGTGTTCACTACACACTTTCAGCTTTCACTTGACCTTTATC
AGACCCTTGACTACTTGTTGAAAGACTTTTGGAGGGAGGAACGACTTTGTGATGCGGCCT
TGTCAGTATTCCTATGCCTGGGCGGCCACCATCTCATTCTGCTCTCCCCAGGATAACTCA
TCATTCCCATGACTTCAGATACTGTCTCTATGCTGGAAACTCTAAAATCTAGTTCTCTGA
GCTCCAAACATACCTGTGATTGTCTAATTGAGTGCTGCTTAAGCATCTCAAAATTGGCGT
GTCTGGAACTGAACTTATGCTGATACCCCCGCATCTGCTCTTTGCCCTGTTAGTGATGAG
GACCCCTCTACTCAGGGAGAAAACTAGGAAATAGCCCTAACTCCTCTGTTTACCTAATAC
CCTTTTCCCTTCTCATCTGTCACCAAGATCACTTGATCTCTGTCTTCAAATTAAATCTCA
AAATCACCTGTTTTCCCTTTCCATTCTCTCGCTCACGCTATTGCAGAGTCACCCAAACTG
GGCATCTGGGTTTCACTCTTGTCCCCTCCCAGGCGGTCTTCCACACAGCAGCCAAGTTGA
TCTCATCACTTCCAGGGCCCTTAGAAGGTCTCCCATTGCCCTGGGATAGATCTTTTAATT
CCTTACGTATTCTTTTCACTGTGGTCCAGCCACAGCTGGGACTGGGGTCCACACTTCCTC
CGCGGGCCCCTAGGGAAGTTCCTGCCTCTGCCTTGAACATACTCTGCCTGCTTGTTGACT
GGTTAAGTTTTTACTTACCCTTTAGGTGATCAGTCTCTCAAAGCAGCTTTTCTTTCTCCT
TCGATCTAAATTATACTCTGCCGTGACTCCTATACTCCACCTTCCATCGGCTGCCCTGCA
GTCTCTAACCCTGTGTCTGTGTGGCTTTGACTGTAAGTGCTAAAGGTAGACTGATTCCCC
TGATTTTGGAGTCCTGTCCTTAGAGTGTCTGGCACACAGTCTTTGTCAGTATATACAGAG
AGGTTTATTTTGAGGTTCATCTTTAATTCGTTTCACTTTAAAAATTCTTTGATCTCATTG
CTCTTCTTTGATAAGTGAAATGGCTTTAATTCTCTGTATATTGACTATTTTTCAAATCTG
TGTCTCTTCCGTCAGCTTGCTGGTGATTTCCATGCTCTATATGAGTGCCCCTTGGCAGCT
TCACAGACTAACGCAGGGACCAAACTCATGTTGTCGAAAGCTGAACTGTACTTTTCTCAT
CCTGCCTCTAACCTGTTAGTATTTATTTCACTCCAGGAGTCAGTGGCTGAACCTCCCAGC
TACCCAAGCCGTAAACGTTGACTTCTCTGTTCAGGCCATCTGTTCTCAGCGCAAACATTC
CTGTCTCTCTAATTATTGCCTCCTTGCCTTTAGTCCTTCATCTTTCCAGTGAGGTTTCCA
CATTAACATTGGGATCCTTTTGAAACACAGATTCAATACCACTACTATTCCTATTTAAAA
ATATTAAACTTCTTACCAGTCCAGACTCTTTGACATCCCTACAAGGTTCTTCATTTTCTG
GTACTACTGGGAATTTCAACTCTTGGCCCCTCTCTCAACTCCAGACTTTCCTTGTTCCAC
CTGCCAGGCTGGATTTATGCCTCTTGTATGCTTGTAATCTGCATTCCACTGTAGTAACCC
TTGTCCCTGGGTTGCAGTTGGCAGTCTCTCCCCCTGCCAGATCCTGGAAGGCAGGGATCC
TGTTTCCTTTCTCACCACAGTGCTTGGTTAGGAACTCAGATTGGGGTAAGGGAGAGCTAA
GTGGTAATTTTTAATTCCTTGAACTTTTCTATAAATTGTCTGATAGATATTCTGGTCATA
GAAGTGGAGGAATGGTTAATATGACTTAATCTGCAATTTTGTGAAAAATACTTAATGGAA
CTTAGAGCTATATTGTATAAAAAACAGAAGACAACTTTGGGTTACTCCTCAAATACTTGA
TCTCTGTAGAGAATCAGATATCACCAAGGAGCGAATCCAGAAGATCCTGGCAACTGGGGC
CAACGTTATTCTCACCACTGGTGGAATTGATGACATGTGTCTGAAGTATTTTGTGGAGAC
TGGTGCCATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCTAAAGCTTC
TGGAGGTATGTCTTGTGCCAGCTCTCAGATACAATACTTCATGTTACTTTCTGTGACTAT
GTCTCTTTATATTGGAATGTTAACGCTTAAGCAGCTTCAAAAACAGAACAGTTTTTACTC
AATGCTTTGTGCTACAAATACATTTATAGAGCCTTTTTTTTTTAAATATAACTGGAAAAG
TTTTTTAACTTAATTTCACCTTAAAATGACAGTTTCATCTTAAGATAAAAGGACAATTGC
TTATCTGCTGCCTAACTGTAAACCTTCAACTTGTATTTATATATCAGTTTTATCATAAAT
GTTTCTGAATCTAAGACAGGATACGAAAATATTCATGGGAATATTGTTTACAGATCTTTG
TAATTATCTTAATAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTT
TTGAAGCTTCAATGTTGGGACAAGCAGAAGAGGTGGTGCAGGAGAGAATTTGTGATGATG
AGCTCATCTTGATCAAAAAGTAAGAGCTACTCAGTAAACTATAAAGCTGCACAGATTTTA
TTCATAAGAACAGATCACCTTCCCATTGATTTGCTGCTATAGTCTCTCAGTGATATGAGC
AGTTATACGCATGGGATAAAATAATACTGGGCCATTGTAAATTGAGATGGAGTAACCATT
TCATCTCTTCTGCATGGCCAAGACATGGCTTCTATGTCCAAATGTCCTGTGTAAGCAGGA
TTTAACCAAGACACTTAACAGTGAATTTCTGTGTAGACTTACTTTATGAAAGAATTAAGA
ATTGCACTTTATTTTTTTTAACAGCACTAAAGCTCGTACATCTGCATCAGTTATCTTACG
TGGGGCGAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGT
AGTGAAGAGAGTTTTGGAGTCAAAATCAGTGGTTCCGGGTGGGGGTGCTGTAGAAGCAGC
CCTGTCCATATATCTTGAAAACTACGCAACCAGCATGGTAAGAACATCTAGAGACCCGTG
TTCTTTTCGACATGGGCCTGGGAGGGATCATCTTGGGCATTTTGTTAATGTACCTCATCT
GAGACCTTAGCTGCTGCTTTGGGTGTTAATTTTTTCCTTCTGTGAAGATGGCTCATTGTC
TGTCTTCTTAGGGGTCTCGGGAACAGCTTGCTATTGCCGAGTTTGCAAGATCTCTTCTTG
TCATTCCTAATACGCTGGCAGTTAATGCTGCCCAAGACTCCACAGATCTGGTTGCAAAGT
TAAGAGCTTTTCATAATGAGGCTCAGGTTAACCCAGAACGCAAAAATCTAAAATGGTAAG
CATACAATCTCCCTGTCTTTTTCATTGTCATCTGTATAGCATCTATGGTAGTTTCGGGGT
TTTTTAAAATTCATGAAGGATGACTAGTGATTATATTAGCATTGGTGTGTCTGGTTAACA
ACCCTGGTTCCTAAGCTCGCCCTGCCTCTGTGGGTAGAGTGACCTCCCCTACAGGAGGGT
CCCACAGAGACAGGGGAGGTGACTTTTGGGTGAGCCATAGCCATTTTGAAGCAACTCCTT
TATAAGATAAGTGATGTTTAGAAACAGTTTCTTTACTGCTATCTAGGCCTTTCTACAGCT
CTTTCAGTGCTGGCTTTGTTATTCATAATCAACTACTTGAATCCTAGAGGGGCCTACCAT
GAATAAGGTCCCAGCATTTCCAAGCTTAACATTTGGATGAAATAGCCTTTAAAGGGATGG
GATGTGTGTGTATTATGTAAGAGGCCATTTAATAGTTTTTTCCTAAAATTGCAGGATTGG
TCTTGATTTGGTCAATGGTAAACCGCGAGACAACAAGCAAGCAGGGGTGTTTGAACCTAC
CATAGTTAAAGTTAAGAGTTTGAAATTTGCCACGGAAGCTGCAATTACAATTCTTCGAAT
TGATGATCTCATTAAATTACACCCAGAAAGCAAAGATGATAAGCATGGAGGTTATGAAGA
TGCTGTTCACTCGGGAGCCCTTGATGGCTGATCTGATTCTCTTTTATTTATAACAATGTT
AGATGCAATTGTCTTGTACCTCGAGTATTACATAATTAAAGTACAACAAGCTGTCAAGCC
TGGGTTCTTGTGAGGTGGGAGATGGTTTCCGTCCTCACTTTGGTCCTCTGACTTCACATA
TTATAGCTTAGTATCTTGTTTAAAAACAAATAAGGTTCAAGGTTAGTTTAAGCATGACAT
TTAAGCAATTTCATCCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCAGA
GGGCAGCAACACCACGATGGCCGCCCTGTCTCTCCAGTGTGTGTAACAGAGTAACAAGAA
TCCGACAGCCAGATGCTCCAAGAGGATGGCCCAAGGCTATAGCCCCTCCTTCAACGTTGA
CCTAAGGGGAAAAGATTTATATCATTTATTCTGTGGGCACAGCGTTCAAATCCTAAACTA
CTACCTTTCCTCTTAATGTTGTACCAGTAAACTATCCTTTTAAGTTCAATTTTTAACTGC
TTAGGAACTGGTTTATACCCCTGTGACATCCATCCCAACTACCTCCCCTTCTTCTTAGTT
TAAAAGATAGAAAAATGCCCTGTTCGTGTTGGAAGTAAACTAGTGCAGCCTCAGTCTTTT
ACCTTGGGGAGCAAGATGAGTGAACTCCGCGTCCCAACAGGACCTTAACCCAGTACCCAC
CACTGCTGCCTGGCCGGCACCAGGGCCGTGTCCTCTAACTGCACAGAGCTGATGAAACTT
AAAATTGCGCTGTGAATGGTCATTTGCAGGCTCTCCTCAGGACTGCGTGCTCATGCTTAC
CTTCTCTGGGTTTAATCCCAGTTCTTTAGCTATCGCAATGGAGAGGGCTGCAAAGGCTTC
ATTGATTTCGAATACGTCAACATCCTCCAGTGACCAGCCTGCTTTTGCGACCTAAAGGAA
AGATGAACAGTCTAAAAAACTTGAGTGGAACCAGTCTTCACTGAAGAAATAAAAGCAGAA
TATAGTGTAGGATAGTGAAGGGTCTCTTAAAAACTGTCACTTTGGGGGCCTAGTGATATC
ACGCATTTTGCCTTGCTAACACCAATTCTAAAGGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 2286..2371, 2580..2708, 3750..3847, 4220..4330, 4569..4750, 5139..5265, 8289..8464, 8835..8958, 9264..9456, 9611..9774, 10254..10556
1001..1070, 2286..2371, 2580..2708, 3750..3847, 4220..4330, 4569..4750, 5139..5265, 8289..8464, 8835..8958, 9264..9456, 9611..9774, 10254..10467
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved