Equus_caballus Locus ENSECAG00000009065
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000009065
Equus_caballus
ENSECAG00000009065
13
SNORA64, SNORA64
1810..1943, 2451..2579
3938
TCTGCCACTTACGGAGTGTGGGACCTTAGGAGTCACCTGACAACCCCCGAGACCCAAGT
TCTCCCCTGGAGTGGTATCCACAGCGAATTGGGCTGGCTGGAAAAGAAGGAGTCCTAATA
GGGTCTCTCCTCCACTGCACATTGTGGTCTGAGGGTCAATAGATGCATTTCCCAGGCTGA
CGGGCAGAGGAACAAAGATATCCAGACACAGATAAGTCAAACTCACACTTTTATTGAAAG
AGGAGAGCAGAGCCCCCTCCCCCGCCCCCCGCAGTACTGGCGGCGTAGTCCTCAGGCTCG
GCATCCGGGTGTCCTGCAGGCAGAAGACAGGGTCAGGGGTCAGAGGCCAGAGCACGCGAG
CAGCTGCGCCGGGAGCGGGAGCGGCGACTCGTGTCGGGGCCTGGGTTTCACCTCCCCACA
CTGAGAAGTGGGCGGTGAGCTGAGGCCTCCGGTGGCTCTGGGCGCCGAATCTCACCCACG
GCCACAGCCAAAGCCGCAGGTGATTTTCAACCAACGCCGATCTCCCGACCACCACCCAGC
GGACAGACCCACAAGCTCCCGAAAACCGGACATACCTGCAGCCCGAGAGGCTAATCTGCC
GCTGCGCGGGCATTTATAGCCGGTCCCACGTCACGCAGATCCCGGGGCTGCGGACCCGCA
GGCACGCAGGCGCGCGCCCCCACGGAGCCAATCACATGCTGTTTTATAGGCTCTCGCGTA
CTCGTAATCGGGGCGGGGCAGCCGAGATCTCGCGGCACTTGGTGTGACATAAAAGGTTCT
TCCCGGGCGCCGTCGTTCTTCTTCTCCGAGAAAACACGTGAGTGTTTTTTCCGTCCTGTT
TGCGTTGTGCAGGCCTGGGCGGCGGGAATCCGCGGGCATCGGGCGGGGCCCAGGCTTGGC
GCGCCCGCGTTCCCGGGTGGGAGCCGCGATCTAGGCGCCCCGGGCGGCTGCGGATGCCAG
TGCCTCACTGACTGGCTGGTTTTTGTCGTTTTCTTTAGCAAATGGCGGATGACGCCGGTG
CTGCGGGAGGGCCTGGAGGCCCCGGGGGCCCTGGACTGGGAAGCCGCGGAGGCTTCCGCG
GAGGCTTCGGCAGTGGCGTCCGGGGCCGGGGTCGCGGTCGTGGTCGGGGCCGGGGCCGAG
GCCGCGGAGCTCGCGGAGGCAAGGCCGAGGACAAGGAGGTAGGTCCGGGCCGTGCTCGTG
AGACGGGCCCGCGGGTGGCGCCTGGCGGGCGGCCGTGGTGACAGGCGCTTTCTCCTCCTC
CAGTGGATCCCCGTCACCAAGCTGGGTCGCCTGGTGAAAGACATGAAGATCAAGTCCCTG
GAGGAAATCTACCTCTTCTCCCTGCCCATTAAGGTAACGCGAGGGTCCTTTTTCCCTGGG
CGGGTCGGTCTCTGGGAGACTCTTCTGGCGTCGGGTCGAGGGGTGCCATTGAGGGGCCCC
AGGCTCCGCGTTTGAGAGGTCGCGTGAGTGCGTGGGGGGTGTCCCATCTGACAGCTGGTA
TTCAAGCTGGGGAGAAAAGGCCGGGCACCCGAAGACCAGTTCTCCTGTTAGGAAGCCGCG
TGAAGGCTCCCAGTGATGAACATTCAGAGGGGGTGGTATTTGCGTTAAACTTATCACTGA
ACGTTTTTGTCAAATCTTTTTTCTCGCAGGAGTCTGAGATCATTGACTTTTTCCTGGGGG
CATCTCTCAAGGACGAGGTTTTGAAGATTATGCCGGTGCAAAAACAGACCCGTGCTGGCC
AGCGGACCAGGTTCAAGGTAGCCCAACCATCGTGTCCTCCTGGGCTGTTTCTGCCAAGGC
GCTTTGTCAGACTCTCTCAGCTCTGCATGGTTACACTTGTTTGCACGCGTGTGACTTTCG
TAATGGGGAGAGAGAGAAAGGATCTCCTCGGGATCTCAGATTGGCCTTGTGGTGGCCTCT
CTTTCCTTGAGGGGCGCGACAGGCCCTGGGCTGTGGTTACTAATGCTGTGTGAGCCACTG
GACCATTAGCCATCTCAGTCTCTTTACAGGCATTTGTTGCCATCGGGGATTACAATGGAC
ATGTCGGTCTGGGTGTGAAGTGCTCCAAGGAGGTAGCTACTGCCATCCGTGGGGCCATCA
TCCTTGCCAAGCTCTCCATTGTCCCCGTGCGACGAGGCTACTGGGGGAACAAGATTGGCA
AGCCCCATACTGTTCCTTGCAAGGTAGGTTGGGCGCTTTTGAGTGATAGGGCCTACAGTG
GTGCAGACTCCAGCTTCAGTCTCCTGACTTCCTCCTTTTCCTTAGGTGACAGGTCGCTGT
GGCTCTGTGCTGGTGCGCCTCATCCCTGCCCCCAGAGGCACTGGCATTGTGTCAGCCCCT
GTGCCCAAGAAGCTCTTGATGATGGCTGGTATTGACGACTGCTACACCTCGGCCAGGGGC
TGTACTGCCACCCTTGGCAACTTTGGTAAGTGGCCCACACATGAGCTGTGGCCTCTCTCA
GCTCCACTTAGTCACACTCAGTGTGTGGTTGGTGTATTTTCAGAGAGAGAGAGGAAGGCC
CTCCTAATGCACGACAGACTGGCCCACAGTGGCCTCTCTGTTCCTAGGAGTGCAACAGCT
TTGGTCTTCATCTGGGATCTCAGATGAATCCATCAACTTTCTGGTCTTTTCCAGCTAAGG
CCACCTTTGATGCCATCTCTAAGACCTACAGCTATCTCACCCCCGACCTCTGGAAAGAGA
CCGTGTTCACCAAGTCTCCCTATCAGGTACTAACTGCCTGACCACCTTGTCAGTCTAGGC
AAATGTGGGGGCGTGGGGTGGCGGCAGCAGGCTTGGCTATAACGAACGCTTTGTCTGTTT
AGGAGTTCACTGACCATCTTGTAAAGAATCACACCAGAGTCTCCGTGCAGAGGACCCAGG
CTCCAGCTGTGGCTACCACATAGTTTTATACAAGAAAAATAAAGTGAATTAAGCCTGTTA
ACAGTTGTCTTGTTTAGTGGTGTTTGAATTTGGAAGGGAGATGGGGCCAATTAAGAATCA
GAATAAAGGCTCATGGGTTTGTTAAGGTCAAGGGCTGAAGGTGACACCAGAACCACAAAC
AGCTTTTGTTACTCTTTATTTTAGTAATGGCCGTAGTCGTGTGAGGGGGCTGCCTCAGGC
AGCAGCTGCCTCTTTAGCGGCTTTTCTCTCTGCTAGCATCCTCTGCTTCTGTTTTGCCAG
GCACTTCCTGGCAGAATAATGGGCCCCAAGGTCGTGATCTGCAAGAGATGGGAGGAGAGG
GGAATCATGGACCACTTCTGTCATGGGGACAGGAGTCTTCGCTACATGTAGAGGGAAGAA
AGGCAGGCAGCTAAGATGGATTGAGCAGAAAGGGGACTCTAAGCATGGTGATTTTATGTG
GGACGTCACCACAGTGTGGTTTGATACCGGGTGTGGAGGTCTGTGCCCTGGATCGAAACT
TGCCCCAGGCCACCTAAGCTGAGTGTGTGAACTTAACCATTACGCCACCAGGCTGGCTGC
AGCATGGTGATTGTTAATGTCTGTAGAAACTGTCACAGATGCAGAGCTGAGAACCACTGT
TTTAGCAGAATTTTTAGCCCATAGTCGTGTGGAGATTGGATATAGGGTTGGGGAGGCAGG
AGGACCCTGAAGGCAGGGGTCAGGCCGGGGTGGGGGCTCACTCACAGCGGTCCTGGTAGG
CCTTGGCCACCTGGGTGAACTGCTCCAGCTCCTTGGCACAGTTCTGCTTGTAGCTCTCAC
CTTCCCTCTGCTGACAGGCCTTCAGCCTTTCCTGGATAATGTTGACAATTTCTTGATCGA
CTTTGCTGAAAGAAAAAGGAACGAGAGAGAGAGAGAGCATATAAGGAGTCCTTTCCTTGT
ACCCAAGAAGAAGAGAATGAAAGGACATTGGAGCCCTACAGTCTGGCCCCTCTACCCCAA
AGATCTGGCCCAGCAGGTGTCGTTTCTGGCTGACCACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 1263..1352, 1649..1756, 2009..2182, 2265..2424, 2634..2725, 2822..2938
1001..1177, 1263..1352, 1649..1756, 2009..2182, 2265..2424, 2634..2725, 2822..2899
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved